rs794726757

Variant names:

• chr2-165994352-A-ATCATGATGCTTATGTCAAAAACTTGTCTGGTTACG
• rs794726757
• NM_001165963.4:c.4611_4645dupCGTAACCAGACAAGTTTTTGACATAAGCATCATGA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001165963.4(SCN1A):​c.4611_4645dupCGTAACCAGACAAGTTTTTGACATAAGCATCATGA​(p.Ile1549ThrfsTer2) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SCN1A NM_001165963.4 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.87
• Publications: 1 publications found

Genes affected

SCN1A (HGNC:10585): (sodium voltage-gated channel alpha subunit 1) Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]

SCN1A-AS1 (HGNC:54069): (SCN1A and SCN9A antisense RNA 1)

LOC102724058 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 2-165994352-A-ATCATGATGCTTATGTCAAAAACTTGTCTGGTTACG is Pathogenic according to our data. Variant chr2-165994352-A-ATCATGATGCTTATGTCAAAAACTTGTCTGGTTACG is described in ClinVar as Pathogenic. ClinVar VariationId is 189918.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001165963.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SCN1A	NM_001165963.4	MANE Select	c.4611_4645dupCGTAACCAGACAAGTTTTTGACATAAGCATCATGA	p.Ile1549ThrfsTer2	frameshift stop_gained	Exon 28 of 29	NP_001159435.1
	SCN1A	NM_001202435.3		c.4611_4645dupCGTAACCAGACAAGTTTTTGACATAAGCATCATGA	p.Ile1549ThrfsTer2	frameshift stop_gained	Exon 27 of 28	NP_001189364.1
	SCN1A	NM_001353948.2		c.4611_4645dupCGTAACCAGACAAGTTTTTGACATAAGCATCATGA	p.Ile1549ThrfsTer2	frameshift stop_gained	Exon 26 of 27	NP_001340877.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SCN1A	ENST00000674923.1	MANE Select	c.4611_4645dupCGTAACCAGACAAGTTTTTGACATAAGCATCATGA	p.Ile1549ThrfsTer2	frameshift stop_gained	Exon 28 of 29	ENSP00000501589.1
	SCN1A	ENST00000303395.9	TSL:5	c.4611_4645dupCGTAACCAGACAAGTTTTTGACATAAGCATCATGA	p.Ile1549ThrfsTer2	frameshift stop_gained	Exon 27 of 28	ENSP00000303540.4
	SCN1A	ENST00000375405.7	TSL:5	c.4578_4612dupCGTAACCAGACAAGTTTTTGACATAAGCATCATGA	p.Ile1538ThrfsTer2	frameshift stop_gained	Exon 25 of 26	ENSP00000364554.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Severe myoclonic epilepsy in infancy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.9
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs794726757; hg19: chr2-166850862;