rs794728438

Variant names:

• chr7-150952457-CGAAGGGGATGGCGGCCACCATGTCGAT-C
• rs794728438
• NM_000238.4:c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC

Variant summary

Our verdict is Pathogenic. The variant received 17 ACMG points: 17P and 0B. PS3 PM1 PM4 PP3 PP5_Very_Strong

The NM_000238.4(KCNH2):​c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC​(p.Ile500_Phe508del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV000234279: Published functional studies demonstrate a damaging effect as this variant yields a protein unable to form functional potassium channels and results in reduced capacity for potassium transport (Sanguinetti et al., 1996)". Synonymous variant affecting the same amino acid position (i.e. I500I) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KCNH2 NM_000238.4 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.80
• Publications: 0 publications found

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

KCNH2 Gene-Disease associations (from GenCC):

• long QT syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• long QT syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• short QT syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• short QT syndrome type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• Brugada syndrome

  Inheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: Genomics England PanelApp, ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 17 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV000234279: Published functional studies demonstrate a damaging effect as this variant yields a protein unable to form functional potassium channels and results in reduced capacity for potassium transport (Sanguinetti et al., 1996)
• PM1: In a hotspot region, there are 7 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 14 uncertain in NM_000238.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000238.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 7-150952457-CGAAGGGGATGGCGGCCACCATGTCGAT-C is Pathogenic according to our data. Variant chr7-150952457-CGAAGGGGATGGCGGCCACCATGTCGAT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 200638.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000238.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNH2	NM_000238.4	MANE Select	c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile500_Phe508del	conservative_inframe_deletion	Exon 6 of 15	NP_000229.1	A0A090N8Q0
	KCNH2	NM_001406753.1		c.1210_1236delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile404_Phe412del	conservative_inframe_deletion	Exon 4 of 13	NP_001393682.1	Q12809-7
	KCNH2	NM_172056.3		c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile500_Phe508del	conservative_inframe_deletion	Exon 6 of 9	NP_742053.1	Q12809-5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNH2	ENST00000262186.10	TSL:1 MANE Select	c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile500_Phe508del	conservative_inframe_deletion	Exon 6 of 15	ENSP00000262186.5	Q12809-1
	KCNH2	ENST00000330883.9	TSL:1	c.478_504delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile160_Phe168del	conservative_inframe_deletion	Exon 2 of 11	ENSP00000328531.4	Q12809-2
	KCNH2	ENST00000461280.2	TSL:1	n.796_822delATCGACATGGTGGCCGCCATCCCCTTC		non_coding_transcript_exon	Exon 2 of 5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Long QT syndrome (1)
1	-	-	Long QT syndrome 2 (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs794728438;

hg19: chr7-150649545;