rs794728438
Variant summary
Our verdict is Pathogenic. The variant received 17 ACMG points: 17P and 0B. PS3PM1PM4PP3PP5_Very_Strong
The NM_000238.4(KCNH2):c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC(p.Ile500_Phe508del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV000234279: Published functional studies demonstrate a damaging effect as this variant yields a protein unable to form functional potassium channels and results in reduced capacity for potassium transport (Sanguinetti et al., 1996)". Synonymous variant affecting the same amino acid position (i.e. I500I) has been classified as Likely benign.
Frequency
Consequence
NM_000238.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- long QT syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- long QT syndrome 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- short QT syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- short QT syndrome type 1Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- Brugada syndromeInheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: Genomics England PanelApp, ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 17 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000238.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNH2 | MANE Select | c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC | p.Ile500_Phe508del | conservative_inframe_deletion | Exon 6 of 15 | NP_000229.1 | A0A090N8Q0 | ||
| KCNH2 | c.1210_1236delATCGACATGGTGGCCGCCATCCCCTTC | p.Ile404_Phe412del | conservative_inframe_deletion | Exon 4 of 13 | NP_001393682.1 | Q12809-7 | |||
| KCNH2 | c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC | p.Ile500_Phe508del | conservative_inframe_deletion | Exon 6 of 9 | NP_742053.1 | Q12809-5 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNH2 | TSL:1 MANE Select | c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC | p.Ile500_Phe508del | conservative_inframe_deletion | Exon 6 of 15 | ENSP00000262186.5 | Q12809-1 | ||
| KCNH2 | TSL:1 | c.478_504delATCGACATGGTGGCCGCCATCCCCTTC | p.Ile160_Phe168del | conservative_inframe_deletion | Exon 2 of 11 | ENSP00000328531.4 | Q12809-2 | ||
| KCNH2 | TSL:1 | n.796_822delATCGACATGGTGGCCGCCATCCCCTTC | non_coding_transcript_exon | Exon 2 of 5 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.