rs794728438

Variant names:

• chr7-150952457-CGAAGGGGATGGCGGCCACCATGTCGAT-C
• rs794728438
• NM_000238.4:c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1 PM4 PP3 PP5_Very_Strong

The NM_000238.4(KCNH2):​c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC​(p.Ile500_Phe508del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. I500I) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KCNH2 NM_000238.4 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.80
• Publications: 0 publications found

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

KCNH2 Gene-Disease associations (from GenCC):

• long QT syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• long QT syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• short QT syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• short QT syndrome type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Brugada syndrome

  Inheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 13 ACMG points.

• PM1: In a hotspot region, there are 7 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 12 uncertain in NM_000238.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000238.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 7-150952457-CGAAGGGGATGGCGGCCACCATGTCGAT-C is Pathogenic according to our data. Variant chr7-150952457-CGAAGGGGATGGCGGCCACCATGTCGAT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 200638.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000238.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNH2	NM_000238.4	MANE Select	c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile500_Phe508del	conservative_inframe_deletion	Exon 6 of 15	NP_000229.1	A0A090N8Q0
	KCNH2	NM_001406753.1		c.1210_1236delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile404_Phe412del	conservative_inframe_deletion	Exon 4 of 13	NP_001393682.1	Q12809-7
	KCNH2	NM_172056.3		c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile500_Phe508del	conservative_inframe_deletion	Exon 6 of 9	NP_742053.1	Q12809-5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNH2	ENST00000262186.10	TSL:1 MANE Select	c.1498_1524delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile500_Phe508del	conservative_inframe_deletion	Exon 6 of 15	ENSP00000262186.5	Q12809-1
	KCNH2	ENST00000330883.9	TSL:1	c.478_504delATCGACATGGTGGCCGCCATCCCCTTC	p.Ile160_Phe168del	conservative_inframe_deletion	Exon 2 of 11	ENSP00000328531.4	Q12809-2
	KCNH2	ENST00000461280.2	TSL:1	n.796_822delATCGACATGGTGGCCGCCATCCCCTTC		non_coding_transcript_exon	Exon 2 of 5

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Long QT syndrome (1)
1	-	-	Long QT syndrome 2 (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs794728438; hg19: chr7-150649545;