rs797044470

Variant names:

• chr11-72225070-CGGCCGCGGAGGAGCTGCTGGCCCGGGCG-C
• rs797044470
• NM_001567.4:c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001567.4(INPPL1):​c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG​(p.Glu32MetfsTer77) variant causes a frameshift change. The variant allele was found at a frequency of 0.00000658 in 151,926 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
• Consequence: INPPL1 NM_001567.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 6.80
• Publications: 1 publications found

Genes affected

INPPL1 (HGNC:6080): (inositol polyphosphate phosphatase like 1) The protein encoded by this gene is an SH2-containing 5'-inositol phosphatase that is involved in the regulation of insulin function. The encoded protein also plays a role in the regulation of epidermal growth factor receptor turnover and actin remodelling. Additionally, this gene supports metastatic growth in breast cancer and is a valuable biomarker for breast cancer. [provided by RefSeq, Jan 2009]

INPPL1 Gene-Disease associations (from GenCC):

• opsismodysplasia

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Orphanet
• schneckenbecken dysplasia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 28 pathogenic variants in the truncated region.
• PP5: Variant 11-72225070-CGGCCGCGGAGGAGCTGCTGGCCCGGGCG-C is Pathogenic according to our data. Variant chr11-72225070-CGGCCGCGGAGGAGCTGCTGGCCCGGGCG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 39481.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
INPPL1	NM_001567.4	c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG	p.Glu32MetfsTer77	frameshift_variant	Exon 1 of 28	ENST00000298229.7	NP_001558.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
INPPL1	ENST00000298229.7	c.94_121delGAGGAGCTGCTGGCCCGGGCGGGCCGCG	p.Glu32MetfsTer77	frameshift_variant	Exon 1 of 28	1	NM_001567.4	ENSP00000298229.2
INPPL1	ENST00000541544.1	n.10_37delGAGGAGCTGCTGGCCCGGGCGGGCCGCG		non_coding_transcript_exon_variant	Exon 1 of 3	2
INPPL1	ENST00000540973.1	c.*20_*47delGGCCGCGGAGGAGCTGCTGGCCCGGGCG		downstream_gene_variant		3		ENSP00000440904.1
INPPL1	ENST00000543234.1	c.*34_*61delGGCCGCGGAGGAGCTGCTGGCCCGGGCG		downstream_gene_variant		2		ENSP00000440512.1

Frequencies

GnomAD3 genomes AF: 0.00000658 AC: 1 AN: 151926 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000241

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.00000658 AC: 1 AN: 151926 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74198

African (AFR) AF: 0.0000241 AC: 1 AN: 41410

American (AMR) AF: 0.00 AC: 0 AN: 15248

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5172

South Asian (SAS) AF: 0.00 AC: 0 AN: 4836

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10530

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67954

Other (OTH) AF: 0.00 AC: 0 AN: 2086

Alfa AF: 0.00 Hom.: 0

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Opsismodysplasia Pathogenic:2

May 28, 2019

Mendelics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jan 10, 2013

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

not provided Pathogenic:1

Jan 30, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Glu32Metfs*77) in the INPPL1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in INPPL1 are known to be pathogenic (PMID: 23273567, 23273569). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individuals with INPPL1-related conditions (PMID: 23273569, 34529350). ClinVar contains an entry for this variant (Variation ID: 39481). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.8
Mutation Taster		=16/184	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs797044470; hg19: chr11-71936114;