rs797044530

Variant names:

• chr3-138945857-T-TGCGGCGGAGGCGGGGGTGCGGCC
• rs797044530
• NM_023067.4:c.843_865dupGGCCGCACCCCCGCCTCCGCCGC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_023067.4(FOXL2):​c.843_865dupGGCCGCACCCCCGCCTCCGCCGC​(p.His289ArgfsTer75) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: FOXL2 NM_023067.4 frameshift
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 3.58
• Publications: 1 publications found

Genes affected

FOXL2 (HGNC:1092): (forkhead box L2) This gene encodes a forkhead transcription factor. The protein contains a fork-head DNA-binding domain and may play a role in ovarian development and function. Expansion of a polyalanine repeat region and other mutations in this gene are a cause of blepharophimosis syndrome and premature ovarian failure 3. [provided by RefSeq, Jul 2016]

FOXL2 Gene-Disease associations (from GenCC):

• blepharophimosis, ptosis, and epicanthus inversus syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• premature ovarian failure 3

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 29 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_023067.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXL2	NM_023067.4	MANE Select	c.843_865dupGGCCGCACCCCCGCCTCCGCCGC	p.His289ArgfsTer75	frameshift	Exon 1 of 1	NP_075555.1	Q53ZD3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FOXL2	ENST00000648323.1	MANE Select	c.843_865dupGGCCGCACCCCCGCCTCCGCCGC	p.His289ArgfsTer75	frameshift	Exon 1 of 1	ENSP00000497217.1	P58012

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: not provided

Revision: no classification provided

Pathogenic	VUS	Benign	Condition
-	-	-	Blepharophimosis, ptosis, and epicanthus inversus syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.6
Mutation Taster		=8/192	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs797044530; hg19: chr3-138664699;