rs797044530
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_023067.4(FOXL2):c.843_865dupGGCCGCACCCCCGCCTCCGCCGC(p.His289ArgfsTer75) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).
Frequency
Consequence
NM_023067.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- blepharophimosis, ptosis, and epicanthus inversus syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
- premature ovarian failure 3Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_023067.4. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.