rs797044820

Variant names:

• chr19-7525092-AAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCT-TCA
• rs797044820
• NM_020533.3:c.163_197delAAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCTinsTCA

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_020533.3(MCOLN1):​c.163_197delAAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCTinsTCA​(p.Lys55SerfsTer22) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MCOLN1 NM_020533.3 frameshift, missense
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 9.53

Genes affected

MCOLN1 (HGNC:13356): (mucolipin TRP cation channel 1) This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]

LOC105372261 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MCOLN1	NM_020533.3	c.163_197delAAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCTinsTCA	p.Lys55SerfsTer22	frameshift_variant, missense_variant	Exon 2 of 14	ENST00000264079.11	NP_065394.1
LOC105372261	XR_936293.3	n.-162_-128delAGCTTGCAGGGCTTGCGGCCCTTGGCTCGAAACTTinsTGA		upstream_gene_variant
LOC105372261	XR_936294.3	n.-162_-128delAGCTTGCAGGGCTTGCGGCCCTTGGCTCGAAACTTinsTGA		upstream_gene_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MCOLN1	ENST00000264079.11	c.163_197delAAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCTinsTCA	p.Lys55SerfsTer22	frameshift_variant, missense_variant	Exon 2 of 14	1	NM_020533.3	ENSP00000264079.5
MCOLN1	ENST00000596390.1	n.279_313delAAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCTinsTCA		non_coding_transcript_exon_variant	Exon 2 of 2	1
MCOLN1	ENST00000601003.1	c.163_197delAAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCTinsTCA	p.Lys55SerfsTer22	frameshift_variant, missense_variant	Exon 2 of 5	3		ENSP00000469074.1
MCOLN1	ENST00000394321.9	n.243_277delAAGTTTCGAGCCAAGGGCCGCAAGCCCTGCAAGCTinsTCA		non_coding_transcript_exon_variant	Exon 2 of 13	2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs797044820; hg19: chr19-7589978;