rs797045725

Variant names:

• chr16-15735401-GTCTTCCAGCTCTGTCTTTAGGGCCTCCAGCTCCTCGCCGAGGTCTCGCT-G
• rs797045725
• NM_002474.3:c.3422_3470delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_002474.3(MYH11):​c.3422_3470delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA​(p.Lys1141ThrfsTer20) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYH11 NM_002474.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 9.17
• Publications: 2 publications found

Genes affected

MYH11 (HGNC:7569): (myosin heavy chain 11) The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. A chromosomal rearrangement involving this gene is associated with acute myeloid leukemia of the M4Eo subtype. Mutations in this gene are associated with visceral myopathy, megacystis-microcolon-intestinal hypoperistalsis syndrome 2, and familial thoracic aortic aneurysm 4. [provided by RefSeq, May 2022]

MYH11 Gene-Disease associations (from GenCC):

• familial thoracic aortic aneurysm and aortic dissection

  Inheritance: AD, Unknown Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• aortic aneurysm, familial thoracic 4

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• megacystis-microcolon-intestinal hypoperistalsis syndrome 2

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• megacystis-microcolon-intestinal hypoperistalsis syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• congenital heart disease

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• visceral myopathy 2

  Inheritance: AD, AR Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-15735401-GTCTTCCAGCTCTGTCTTTAGGGCCTCCAGCTCCTCGCCGAGGTCTCGCT-G is Pathogenic according to our data. Variant chr16-15735401-GTCTTCCAGCTCTGTCTTTAGGGCCTCCAGCTCCTCGCCGAGGTCTCGCT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 211548.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002474.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYH11	NM_002474.3	MANE Select	c.3422_3470delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1141ThrfsTer20	frameshift	Exon 26 of 41	NP_002465.1	P35749-1
	MYH11	NM_001040113.2	MANE Plus Clinical	c.3443_3491delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1148ThrfsTer20	frameshift	Exon 27 of 43	NP_001035202.1	P35749-3
	MYH11	NM_001040114.2		c.3443_3491delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1148ThrfsTer20	frameshift	Exon 27 of 42	NP_001035203.1	P35749-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MYH11	ENST00000300036.6	TSL:1 MANE Select	c.3422_3470delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1141ThrfsTer20	frameshift	Exon 26 of 41	ENSP00000300036.5	P35749-1
	MYH11	ENST00000452625.7	TSL:1 MANE Plus Clinical	c.3443_3491delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1148ThrfsTer20	frameshift	Exon 27 of 43	ENSP00000407821.2	P35749-3
	MYH11	ENST00000396324.7	TSL:1	c.3443_3491delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1148ThrfsTer20	frameshift	Exon 27 of 42	ENSP00000379616.3	P35749-2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Aortic aneurysm, familial thoracic 4 (1)
1	-	-	Megacystis-microcolon-intestinal hypoperistalsis syndrome 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs797045725; hg19: chr16-15829258;