rs797045725

Positions:

• chr16-15735401-GTCTTCCAGCTCTGTCTTTAGGGCCTCCAGCTCCTCGCCGAGGTCTCGCT-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_002474.3(MYH11):​c.3422_3470delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA​(p.Lys1141fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MYH11 NM_002474.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 9.17

Genes affected

MYH11 (HGNC:7569): (myosin heavy chain 11) The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. A chromosomal rearrangement involving this gene is associated with acute myeloid leukemia of the M4Eo subtype. Mutations in this gene are associated with visceral myopathy, megacystis-microcolon-intestinal hypoperistalsis syndrome 2, and familial thoracic aortic aneurysm 4. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 16-15735401-GTCTTCCAGCTCTGTCTTTAGGGCCTCCAGCTCCTCGCCGAGGTCTCGCT-G is Pathogenic according to our data. Variant chr16-15735401-GTCTTCCAGCTCTGTCTTTAGGGCCTCCAGCTCCTCGCCGAGGTCTCGCT-G is described in ClinVar as [Pathogenic]. Clinvar id is 211548.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MYH11	NM_002474.3	c.3422_3470delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1141fs	frameshift_variant	26/41	ENST00000300036.6	NP_002465.1
MYH11	NM_001040113.2	c.3443_3491delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1148fs	frameshift_variant	27/43	ENST00000452625.7	NP_001035202.1
MYH11	NM_001040114.2	c.3443_3491delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1148fs	frameshift_variant	27/42		NP_001035203.1
MYH11	NM_022844.3	c.3422_3470delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1141fs	frameshift_variant	26/42		NP_074035.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MYH11	ENST00000300036.6	c.3422_3470delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1141fs	frameshift_variant	26/41	1	NM_002474.3	ENSP00000300036.5
MYH11	ENST00000452625.7	c.3443_3491delAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGA	p.Lys1148fs	frameshift_variant	27/43	1	NM_001040113.2	ENSP00000407821.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Megacystis-microcolon-intestinal hypoperistalsis syndrome 2 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

May 27, 2021

- -

Aortic aneurysm, familial thoracic 4 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Genetic Services Laboratory, University of Chicago

Jul 16, 2015

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs797045725; hg19: chr16-15829258;