rs80338665

Positions:

• chr1-235728073-CACCGAACTTTCAACTGTATCAGAAGCATTATCTTCCACAAAATACATTCCACATTT-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_000081.4(LYST):​c.9109_9162+2delAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCGGT​(p.Lys3037_Ser3054del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: LYST NM_000081.4 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 8.32

Genes affected

LYST (HGNC:1968): (lysosomal trafficking regulator) This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]

LYST (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
LYST	NM_000081.4	c.9109_9162+2delAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCGGT	p.Lys3037_Ser3054del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	38/53	ENST00000389793.7	NP_000072.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
LYST	ENST00000389793.7	c.9109_9162+2delAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCGGT	p.Lys3037_Ser3054del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	38/53	5	NM_000081.4	ENSP00000374443.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs80338665; hg19: chr1-235891373;