rs80338665
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000081.4(LYST):c.9109_9162+2delAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCGGT(p.Lys3037_Ser3054del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_000081.4 splice_donor, conservative_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Chediak-Higashi syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Genomics England PanelApp
- attenuated Chédiak-Higashi syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000081.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LYST | MANE Select | c.9109_9162+2delAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCGGT | p.Lys3037_Ser3054del | splice_donor conservative_inframe_deletion splice_region intron | Exon 38 of 53 | NP_000072.2 | Q99698-1 | ||
| LYST | c.9109_9162+2delAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCGGT | p.Lys3037_Ser3054del | splice_donor conservative_inframe_deletion splice_region intron | Exon 38 of 53 | NP_001288294.1 | Q99698-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LYST | TSL:5 MANE Select | c.9109_9162+2delAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCGGT | p.Lys3037_Ser3054del | splice_donor conservative_inframe_deletion splice_region intron | Exon 38 of 53 | ENSP00000374443.2 | Q99698-1 | ||
| LYST | c.3589_3642+2delAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCGGT | p.Lys1197_Ser1214del | splice_donor conservative_inframe_deletion splice_region intron | Exon 22 of 26 | ENSP00000513206.1 | A0A8V8TM69 | |||
| LYST | TSL:5 | c.1204_1257+2delAAATGTGGAATGTATTTTGTGGAAGATAATGCTTCTGATACAGTTGAAAGTTCGGT | p.Lys402_Ser419del | splice_donor conservative_inframe_deletion splice_region intron | Exon 10 of 15 | ENSP00000513164.1 | A0A8V8TM32 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at