rs80359736

Positions:

• chr13-32379768-GTCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PM2 PM4 PP5_Very_Strong

The NM_000059.4(BRCA2):​c.8975_9100del​(p.Pro2992_Thr3033del) variant causes a inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BRCA2 NM_000059.4 inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:7 U:1
• Conservation: PhyloP100: 7.12

Genes affected

BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000059.4.
• PP5: Variant 13-32379768-GTCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC-G is Pathogenic according to our data. Variant chr13-32379768-GTCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 96876.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
BRCA2	NM_000059.4	c.8975_9100del	p.Pro2992_Thr3033del	inframe_deletion	23/27	ENST00000380152.8	NP_000050.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
BRCA2	ENST00000380152.8	c.8975_9100del	p.Pro2992_Thr3033del	inframe_deletion	23/27	5	NM_000059.4	ENSP00000369497	A2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:7 Uncertain:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

Likely pathogenic, criteria provided, single submitter	clinical testing	GeneDx	Mar 14, 2017	This in-frame deletion of 126 nucleotides is denoted BRCA2 c.8975_9100del126 at the cDNA level, p.Pro2992_Thr3033del (P2992_T3033del) at the protein level, and results in the loss of 42 residues. The surrounding sequence is CGTC[del126]AGTA. Also reported as BRCA2 9203_9328del126 and 9203del126 using alternate nomenclature, this variant has been observed in at least six families with breast, ovarian, and/or pancreatic cancer and was shown to segregate with disease in one of these families (Slater 2010, Rath 2012). BRCA2 c.8975_9100del126 was not observed in large population cohorts (NHLBI Exome Sequencing Project, The 1000 Genomes Consortium 2015, Lek 2016). Even though this variant results in an in-frame transcript, the deleted region includes several residues that are conserved and it is located within the DNA binding domain (Yang 2002). Based on currently available evidence, we consider BRCA2 c.8975_9100del126 to be likely pathogenic. -
Likely pathogenic, criteria provided, single submitter	clinical testing	Mayo Clinic Laboratories, Mayo Clinic	Sep 22, 2022	PP5, PM2, PM4, PS4_moderate -

Hereditary cancer-predisposing syndrome Pathogenic:2

Likely pathogenic, criteria provided, single submitter	clinical testing	Color Diagnostics, LLC DBA Color Health	Feb 08, 2022	This variant (also known as c.9203_9328del126) causes an in-frame deletion of 42 amino acids in the DNA binding domain of the BRCA2 protein. To our knowledge, functional studies have not been reported for this variant. This variant has been reported in individuals affected with breast cancer, ovarian cancer and pancreatic cancer (PMID: 20195775, 22228431). One family study has shown this variant to segregate with breast and pancreatic cancer in 4 family members, while the variant was absent 4 unaffected family members older than age 67 years (PMID: 20195775). Additionally, a multi-factorial likelihood analysis using health history, in silico prediction, and co-occurrence with known pathogenic variant has suggested this variant has a high probability of being pathogenic (PMID: 31131967). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Based on the available evidence, this variant is classified as Likely Pathogenic. -
Likely pathogenic, criteria provided, single submitter	clinical testing	Ambry Genetics	Jan 10, 2024	The c.8975_9100del126 variant (also known as p.P2992_T3033del) is located in coding exon 22 of the BRCA2 gene. This variant results from an in-frame deletion of 126 nucleotides at positions 8975 to 9100. This results in the in-frame deletion of 42 amino acids between codons 2992 and 3033. This alteration has been detected in multiple breast and/or ovarian and/or pancreatic cancer families and has been shown to segregate with disease (Slater EP et al. Fam Cancer. 2010 Sep;9(3):335-43; Rath MG et al. Breast Cancer Res Treat. 2012 Jun;133(2):725-34; Bartsch DK et al. Fam Cancer. 2013 Mar;12(1):89-96; Lincoln SE et al. J Mol Diagn. 2015 Sep;17(5):533-44). This alteration was significantly enriched in a breast cancer-affected cohort compared to a large control population, where it was not identified (Rath MG et al. Breast Cancer Res Treat. 2012 Jun;133(2):725-34). Of note, this alteration is also designated as 9203del126 in published literature. This deletion occurs in the OB2 domain which is essential for DNA binding and internal structural analysis indicates that this alteration will likely impact protein function (Ambry internal data). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Hereditary breast ovarian cancer syndrome Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Nov 25, 2022	Variant summary: BRCA2 c.8975_9100del126 (p.Pro2992_Thr3033del) results in an in-frame deletion that is predicted to remove 42 amino acids from the encoded protein. The variant was absent in 250784 control chromosomes. c.8975_9100del126 has been reported in the literature in multiple individuals affected with Hereditary Breast And Ovarian Cancer Syndrome (Lincoln_2015, Rath_2012 and Slater_2010 etc.). These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Four clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Nov 19, 2023	This variant, c.8975_9100del, results in the deletion of 42 amino acid(s) of the BRCA2 protein (p.Pro2992_Thr3033del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with BRCA2-related conditions (PMID: 20195775, 22228431, 23179793, 26207792). It has also been observed to segregate with disease in related individuals. This variant is also known as 9203del126. ClinVar contains an entry for this variant (Variation ID: 96876). RNA analysis performed to evaluate the impact of this variant on mRNA splicing indicates it does not significantly alter splicing (Invitae). This variant disrupts a region of the BRCA2 protein in which other variant(s) (p.Glu3002Lys) have been determined to be pathogenic (PMID: 20694749, 21947752, 22678057; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Breast-ovarian cancer, familial, susceptibility to, 2 Pathogenic:1 Uncertain:1

Likely pathogenic, no assertion criteria provided	clinical testing	Sharing Clinical Reports Project (SCRP)	Jun 26, 2013	- -
Uncertain significance, no assertion criteria provided	clinical testing	Breast Cancer Information Core (BIC) (BRCA2)	Feb 20, 2004	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs80359736; hg19: chr13-32953905;