rs80359874

Variant names:

• chr17-43094316-TGATTCAGACTCCCCATCATGTGAGTCATCAGAACCTAACA-T
• rs80359874
• NM_007294.4:c.1175_1214delTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_007294.4(BRCA1):​c.1175_1214delTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC​(p.Leu392GlnfsTer5) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000743 in 1,614,088 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. L392L) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000068 (0 hom.)
• Consequence: BRCA1 NM_007294.4 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:28
• Conservation: PhyloP100: 2.42
• Publications: 20 publications found

Genes affected

BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

BRCA1 Gene-Disease associations (from GenCC):

• breast-ovarian cancer, familial, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• Fanconi anemia, complementation group S

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• pancreatic cancer, susceptibility to, 4

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 17-43094316-TGATTCAGACTCCCCATCATGTGAGTCATCAGAACCTAACA-T is Pathogenic according to our data. Variant chr17-43094316-TGATTCAGACTCCCCATCATGTGAGTCATCAGAACCTAACA-T is described in ClinVar as Pathogenic. ClinVar VariationId is 17665.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BRCA1	NM_007294.4	c.1175_1214delTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC	p.Leu392GlnfsTer5	frameshift_variant	Exon 10 of 23	ENST00000357654.9	NP_009225.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BRCA1	ENST00000357654.9	c.1175_1214delTGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATC	p.Leu392GlnfsTer5	frameshift_variant	Exon 10 of 23	1	NM_007294.4	ENSP00000350283.3

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152230 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000797 AC: 2 AN: 250822 AF XY: 0.00000738

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000883

Gnomad OTH exome AF: 0.000164

GnomAD4 exome AF: 0.00000684 AC: 10 AN: 1461858 Hom.: 0 AF XY: 0.00000825 AC XY: 6 AN XY: 727230

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26134

East Asian (EAS) AF: 0.00 AC: 0 AN: 39692

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53412

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000719 AC: 8 AN: 1112004

Other (OTH) AF: 0.0000331 AC: 2 AN: 60392

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000000023301), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152230 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74382

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41462

American (AMR) AF: 0.00 AC: 0 AN: 15278

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5196

South Asian (SAS) AF: 0.00 AC: 0 AN: 4838

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10624

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000294 AC: 2 AN: 68044

Other (OTH) AF: 0.00 AC: 0 AN: 2090

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.00000037155), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:28

Revision: reviewed by expert panel

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 1 Pathogenic:11

May 06, 2021

Victorian Clinical Genetics Services, Murdoch Childrens Research Institute

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0102 - Loss of function is a known mechanism of disease in this gene and is associated with a risk of breast and ovarian cancer (MIM#604370), fanconi anemia, complementation group S (MIM#617883) and other types of cancer (OMIM). (I). 0108 - This gene is associated with both recessive and dominant disease. Autosomal recessive inheritance of variants is associated with fanconi anaemia, complementation group S (MIM#617883), whilst autosomal dominant inheritance is associated with an increased risk for familial breast and/or ovarian cancer, 1 (MIM#604370), or pancreatic cancer susceptibility, 4 (MIM#614320). The gene has also been reported to be associated with increased risk for prostate and stomach cancer (PMID: 26236408). (I) 0112 - The condition associated with this gene has incomplete penetrance (OMIM, Gene Reviews). (I) 0201 - Variant is predicted to cause nonsense-mediated decay (NMD) and loss of protein (premature termination codon is located at least 54 nucleotides upstream of the final exon-exon junction). (SP) 0251 - This variant is heterozygous. (I) 0302 - Variant is present in gnomAD (v2) <0.001 for a dominant condition (2 heterozygotes, 0 homozygotes). (SP) 0701 - Multiple NMD predicted variants comparable to the one identified in this case have very strong previous evidence for pathogenicity (ClinVar, PMID: 31706072). (SP) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. This variant is one of the most common pathogenic BRCA1 variants reported in individuals with breast cancer (ClinVar, PMID: 31706072)). (SP) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign -

Aug 14, 2015

Counsyl

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

Jul 04, 2017

Bioinformatics dept., Datar Cancer Genetics Limited, India

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Mar 18, 2024

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 12, 2017

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 29, 2002

Breast Cancer Information Core (BIC) (BRCA1)

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Dec 01, 1994

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Oct 02, 2015

Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Apr 22, 2016

Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)

Significance: Pathogenic

Review Status: reviewed by expert panel

Collection Method: curation

Variant allele predicted to encode a truncated non-functional protein. -

Feb 10, 2015

Department of Medical Genetics, Oslo University Hospital

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 01, 2012

Sharing Clinical Reports Project (SCRP)

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Hereditary breast ovarian cancer syndrome Pathogenic:5

Jul 15, 2021

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Leu392GlnfsX5 variant in BRCA1 has been reported in >30 individuals with BRCA1-associated cancers (Neuhausen 1996 PMID: 8571953; Castera 2014 PMID:24549055; Watson 2014 PMID:24307375; Kondrashova 2017 PMID:28588062; Trujillano 2015 PMID: 25556971; Risch 2001 PMID: 11179017, Robertson 2012 PMID: 22333603; Breast Cancer Information Core (BIC) database: https://research.nhgri.nih.gov/bic/) and segregated with disease in multiple individuals from many families (Neuhausen 1996 PMID: 8571953). It has also been identified in 0.003% (2/68044) of European chromosomes by gnomAD (http://gnomad.broadinstitute.org, v.3.1). This frequency is low enough to be consistent with the frequency of hereditary breast and ovarian cancer (HBOC) in the general population. This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 392 and leads to a premature termination codon 5 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Heterozygous loss of function of the BRCA1 gene is an established disease mechanism in hereditary breast and ovarian cancer (HBOC). Additionally, this variant was classified as pathogenic on Apr 22, 2016 by the ClinGen-approved ENIGMA expert panel (Variation ID 17665). In summary, this variant meets criteria to be classified as pathogenic for autosomal dominant HBOC. ACMG/AMP Criteria applied: PS4, PP1_Strong, PM2_Supporting, PVS1. -

Jan 31, 2014

Research Molecular Genetics Laboratory, Women's College Hospital, University of Toronto

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Aug 06, 2021

National Institute of Allergy and Infectious Diseases - Centralized Sequencing Program, National Institutes of Health

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jan 15, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Leu392Glnfs*5) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant is present in population databases (rs80359874, gnomAD 0.0009%). This premature translational stop signal has been observed in individual(s) with breast and/or ovarian cancer and prostate cancer (PMID: 7894491, 8571953, 10682686, 11179017, 17688236, 19648928, 21324516, 22333603, 23569316, 25556971). It is commonly reported in individuals of British and Irish ancestry (PMID: 8571953, 10682686). This variant is also known as 1294del40. ClinVar contains an entry for this variant (Variation ID: 17665). For these reasons, this variant has been classified as Pathogenic. -

Apr 12, 2017

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: The BRCA1 c.1175_1214del40 (p.Leu392Glnfs) variant results in a premature termination codon, predicted to cause a truncated or absent BRCA1 protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory (e.g., c.1236_1237dupAT [p.Leu413fs). One in silico tool predicts a damaging outcome for this variant. This variant was found in the large control database ExAC at a frequency of 0.0000082 (1/121238 control chromosomes), which does not exceed the estimated maximal expected allele frequency of a pathogenic BRCA1 variant (0.0010005). Studies have detected this variant in breast and ovarian cancer patient populations, and the variant has been found to cosegregate with disease in families (Neuhausen_AJHG_1996). In addition, multiple clinical diagnostic laboratories/reputable databases have classified this variant as pathogenic. Taken together, this variant is classified as pathogenic. -

not provided Pathogenic:4

Nov 18, 2022

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Observed in individuals with a personal or family history consistent with pathogenic variants in this gene (Castilla et al., 1994; Simard et al. 1994; Zhang et al., 2011; Strom et al., 2015); Truncating variants in this gene are considered pathogenic by a well-established clinical consortium and/or database; Not observed at significant frequency in large population cohorts (gnomAD); Also known as 1294_1333del40 and 1294del40; This variant is associated with the following publications: (PMID: 25685387, 10923033, 27221860, 27533253, 25556971, 21324516, 26295337, 7894492, 7894491, 27225819, 30322717, 29339979, 14658222, 26681312, 25085752, 23569316, 22333603, 21080930, 20043088, 19648928) -

Jul 16, 2024

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The BRCA1 c.1175_1214del (p.Leu392Glnfs*5) variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. This variant has been reported in the published literature in individuals and families with prostate cancer and hereditary breast and/or ovarian cancer in the published literature (PMIDs: 34657373 (2022), 30322717 (2018), 28888541 (2017), 26681312 (2015), 23569316 (2013), 21324516 (2011), 17688236 (2007), 11179017 (2001), 10682686 (2000), 7894491 (1994)), including an early onset breast cancer case under the age of 30 (PMID: 33758026 (2022)). Based on the available information, this variant is classified as pathogenic. -

Jun 17, 2021

Institute of Medical Genetics and Applied Genomics, University Hospital Tübingen

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 12, 2017

Eurofins Ntd Llc (ga)

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Pathogenic:3

Dec 04, 2023

Color Diagnostics, LLC DBA Color Health

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant deletes 40 nucleotides in exon 10 of the BRCA1 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in many individuals affected with breast and ovarian cancer (PMID: 8571953, 21324516, 22333603, 25556971, 26057125), including 13 individuals affected with breast cancer and 17 individuals affected with ovarian cancer from 6 families (PMID: 8571953). In a large breast cancer case-control study, this variant has been observed in 4/60466 cases and 1/53461 unaffected controls (PMID: 33471991). This variant has been identified in 2/250822 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA1 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Nov 15, 2021

Sema4, Sema4

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

- -

Nov 02, 2018

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1175_1214del40 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a deletion of 40 nucleotides at positions 1175 to 1214, causing a translational frameshift with a predicted alternate stop codon (p.L392Qfs*5). This pathogenic mutation has been reported in numerous individuals diagnosed with breast and/or ovarian cancer (Neuhausen SL et al. Am. J. Hum. Genet. 1996 Feb;58:271-80; Zhang S et al. Gynecol. Oncol. 2011 May;121:353-7; Pruss D et al. Breast Cancer Res. Treat. 2014 Aug;147:119-32; Trujillano D et al. J. Mol. Diagn. 2015 Mar;17:162-70). This alteration also was identified in 3/10030 consecutive patients referred for evaluation by an NGS hereditary cancer panel and one patient also carried a CHEK2 pathogenic mutation. This individual's clinical history included colon polyps and bladder, colon, male breast, prostate, and urethral cancers as well as lymphoma (Susswein LR et al. Genet. Med. 2016 Aug;18:823-32). Of note, this alteration is also designated as 1294del40 in published literature. In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

not specified Pathogenic:2

Dec 04, 2018

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The BRCA1 c.1175_1214del; p.Leu392fs variant (rs80359874), also known as 1294del40, is reported in the literature in multiple individuals affected with breast, ovarian, or prostate cancer (Castilla 1994, Castro 2013, Liede 2000, Neuhausen 1996, Ramus 2007, Risch 2001, Robertson 2012, Zhang 2011). This variant is reported as pathogenic by numerous laboratories in ClinVar (Variation ID: 17665). It is found in the general population with a low overall allele frequency of 0.0008% (2/250822 alleles) in the Genome Aggregation Database. This variant causes a frameshift by deleting 40 nucleotides, so it is predicted to result in a truncated protein or mRNA subject to nonsense-mediated decay. Based on available information, this variant is considered to be pathogenic. REFERENCES Castilla LH et al. Mutations in the BRCA1 gene in families with early-onset breast and ovarian cancer. Nat Genet. 1994 Dec;8(4):387-91. Castro E et al. Germline BRCA mutations are associated with higher risk of nodal involvement, distant metastasis, and poor survival outcomes in prostate cancer. J Clin Oncol. 2013 May 10;31(14):1748-57. Liede A et al. Evidence of a founder BRCA1 mutation in Scotland. Br J Cancer. 2000 Feb;82(3):705-11. Neuhausen SL et al. Haplotype and phenotype analysis of six recurrent BRCA1 mutations in 61 families: results of an international study. Am J Hum Genet. 1996 Feb;58(2):271-80. Ramus SJ et al. Contribution of BRCA1 and BRCA2 mutations to inherited ovarian cancer. Hum Mutat. 2007 Dec;28(12):1207-15. Risch HA et al. Prevalence and penetrance of germline BRCA1 and BRCA2 mutations in a population series of 649 women with ovarian cancer. Am J Hum Genet. 2001 Mar;68(3):700-10. Robertson L et al. BRCA1 testing should be offered to individuals with triple-negative breast cancer diagnosed below 50 years. Br J Cancer. 2012 Mar 13;106(6):1234-8. Zhang S et al. Frequencies of BRCA1 and BRCA2 mutations among 1,342 unselected patients with invasive ovarian cancer. Gynecol Oncol. 2011 May 1;121(2):353-7. -

Jul 01, 2016

GeneKor MSA

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Breast and/or ovarian cancer Pathogenic:1

Apr 03, 2021

CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

BRCA1-related cancer predisposition Pathogenic:1

Aug 08, 2024

All of Us Research Program, National Institutes of Health

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant deletes 40 nucleotides in exon 10 of the BRCA1 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in many individuals affected with breast and ovarian cancer (PMID: 8571953, 21324516, 22333603, 25556971, 26057125), including 13 individuals affected with breast cancer and 17 individuals affected with ovarian cancer from 6 families (PMID: 8571953). In a large breast cancer case-control study, this variant has been observed in 4/60466 cases and 1/53461 unaffected controls (PMID: 33471991). This variant has been identified in 2/250822 chromosomes in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA1 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Malignant tumor of breast Pathogenic:1

-

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The BRCA1 p.Leu392Glnfs*5 variant was identified in 15 of 7220 proband chromosomes (frequency: 0.002) from individuals or families with breast, ovarian and prostate cancer (Castilla 1994, Simard 1994, Neuhausen 1996, Risch 2001, Robertson 2012, Trujillano 2015, Castro 2013, Ramus 2007). The variant was identified in dbSNP (rs80359874) as “with pathogenic allele”, ClinVar (interpreted as "pathogenic" by Invitae and 17 others), LOVD 3.0 (observed 12x) and UMD-LSDB (observed 1x). The variant was not identified in the following control databases: the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (Feb 27, 2017). The c.1175_1214del variant is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at codon 392 and leads to a premature stop codon at position 396. This alteration is then predicted to result in a truncated or absent protein and loss of function. Loss of function variants of the BRCA1 gene are an established mechanism of disease in hereditary breast and ovarian cancer and is the type of variant expected to cause the disorder. In summary, based on the above information this variant meets our laboratory’s criteria to be classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.4
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs80359874; hg19: chr17-41246333;