rs863224229

Variant names:

• chr9-133356440-GCCACCGCCGCCATCGCACCCGGCC-G
• rs863224229
• NM_003172.4:c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_003172.4(SURF1):​c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG​(p.Met1_Ala5del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000475 in 1,263,294 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000047 (0 hom.)
• Consequence: SURF1 NM_003172.4 start_lost, conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 1.28

Genes affected

SURF1 (HGNC:11474): (SURF1 cytochrome c oxidase assembly factor) This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]

SURF2 (HGNC:11475): (surfeit 2) This gene shares a bidirectional promoter with surfeit 1 (SURF1; GeneID: 6834), which is located on the opposite strand. It encodes a conserved protein that is expressed in a variety of tissues. [provided by RefSeq, Jul 2013]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 9-133356440-GCCACCGCCGCCATCGCACCCGGCC-G is Pathogenic according to our data. Variant chr9-133356440-GCCACCGCCGCCATCGCACCCGGCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 215241.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SURF1	NM_003172.4	c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG	p.Met1_Ala5del	start_lost, conservative_inframe_deletion	Exon 1 of 9	ENST00000371974.8	NP_003163.1
SURF1	NM_003172.4	c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG		5_prime_UTR_variant	Exon 1 of 9	ENST00000371974.8	NP_003163.1
SURF2	NM_017503.5	c.-152_-129delCCACCGCCGCCATCGCACCCGGCC		upstream_gene_variant		ENST00000371964.5	NP_059973.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SURF1	ENST00000371974.8	c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG	p.Met1_Ala5del	start_lost, conservative_inframe_deletion	Exon 1 of 9	1	NM_003172.4	ENSP00000361042.3
SURF1	ENST00000371974.8	c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG		5_prime_UTR_variant	Exon 1 of 9	1	NM_003172.4	ENSP00000361042.3
SURF2	ENST00000371964.5	c.-152_-129delCCACCGCCGCCATCGCACCCGGCC		upstream_gene_variant		1	NM_017503.5	ENSP00000361032.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000475 AC: 6 AN: 1263294 Hom.: 0 AF XY: 0.00000322 AC XY: 2 AN XY: 620592

Gnomad4 AFR exome AF: 0.0000396

Gnomad4 AMR exome AF: 0.0000481

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000157

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000295

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000756

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Leigh syndrome Pathogenic:2

Sep 08, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Experimental studies have shown that disruption of the initiator codon affects SURF1 function (PMID: 27756633). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. ClinVar contains an entry for this variant (Variation ID: 215241). Disruption of the initiator codon has been observed in individual(s) with Leigh syndrome (PMID: 27756633). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the SURF1 mRNA. The next in-frame methionine is located at codon 110. -

Dec 28, 2015

Center for Neuroscience and Cell Biology, University of Coimbra, Portugal

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Charcot-Marie-Tooth disease type 4K;C5435656:Mitochondrial complex IV deficiency, nuclear type 1 Pathogenic:1

Feb 23, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

Mar 12, 2012

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.-11_c.13delGGCCGGGTGCGATGGCGGCGGTGG mutation in the SURF1 gene is predicted to result in the loss of the initiator Methionine codon. As this mutation results in the deletion of the translation initiator codon, it is predicted to prevent protein translation, or if translation proceeded with an alternate methionine, would lead to an abnormal protein product. Although this mutation has not been reported previously to our knowledge, it is expected to be a disease-causing mutation. The variant is found in MITO24 panel(s). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs863224229; hg19: chr9-136223316;