rs863224229

Variant names:

• chr9-133356440-GCCACCGCCGCCATCGCACCCGGCC-G
• rs863224229
• NM_003172.4:c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_003172.4(SURF1):​c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG​(p.Met1_Ala5del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000475 in 1,263,294 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000047 (0 hom.)
• Consequence: SURF1 NM_003172.4 start_lost, conservative_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 1.28
• Publications: 2 publications found

Genes affected

SURF1 (HGNC:11474): (SURF1 cytochrome c oxidase assembly factor) This gene encodes a protein localized to the inner mitochondrial membrane and thought to be involved in the biogenesis of the cytochrome c oxidase complex. The protein is a member of the SURF1 family, which includes the related yeast protein SHY1 and rickettsial protein RP733. The gene is located in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity, where it shares a bidirectional promoter with SURF2 on the opposite strand. Defects in this gene are a cause of Leigh syndrome, a severe neurological disorder that is commonly associated with systemic cytochrome c oxidase deficiency. [provided by RefSeq, Jul 2008]

SURF2 (HGNC:11475): (surfeit 2) This gene shares a bidirectional promoter with surfeit 1 (SURF1; GeneID: 6834), which is located on the opposite strand. It encodes a conserved protein that is expressed in a variety of tissues. [provided by RefSeq, Jul 2013]

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PP5: Variant 9-133356440-GCCACCGCCGCCATCGCACCCGGCC-G is Pathogenic according to our data. Variant chr9-133356440-GCCACCGCCGCCATCGCACCCGGCC-G is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 215241.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003172.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SURF1	NM_003172.4	MANE Select	c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG	p.Met1_Ala5del	start_lost conservative_inframe_deletion	Exon 1 of 9	NP_003163.1	Q15526-1
	SURF1	NM_003172.4	MANE Select	c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG		5_prime_UTR	Exon 1 of 9	NP_003163.1	Q15526-1
	SURF1	NM_001280787.1		c.-286_-263delGGCCGGGTGCGATGGCGGCGGTGG		5_prime_UTR	Exon 1 of 8	NP_001267716.1	A0A087WYS9

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SURF1	ENST00000371974.8	TSL:1 MANE Select	c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG	p.Met1_Ala5del	start_lost conservative_inframe_deletion	Exon 1 of 9	ENSP00000361042.3	Q15526-1
	SURF1	ENST00000371974.8	TSL:1 MANE Select	c.-11_13delGGCCGGGTGCGATGGCGGCGGTGG		5_prime_UTR	Exon 1 of 9	ENSP00000361042.3	Q15526-1
	SURF1	ENST00000615505.4	TSL:1	c.-286_-263delGGCCGGGTGCGATGGCGGCGGTGG		5_prime_UTR	Exon 1 of 8	ENSP00000482067.1	A0A087WYS9

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00 AC: 0 AN: 60112 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000475 AC: 6 AN: 1263294 Hom.: 0 AF XY: 0.00000322 AC XY: 2 AN XY: 620592

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000396 AC: 1 AN: 25270

American (AMR) AF: 0.0000481 AC: 1 AN: 20770

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 21458

East Asian (EAS) AF: 0.00 AC: 0 AN: 27056

South Asian (SAS) AF: 0.0000157 AC: 1 AN: 63732

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 31422

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3698

European-Non Finnish (NFE) AF: 0.00000295 AC: 3 AN: 1018046

Other (OTH) AF: 0.00 AC: 0 AN: 51842

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000707862), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Leigh syndrome (2)
1	-	-	Charcot-Marie-Tooth disease type 4K;C5435656:Mitochondrial complex IV deficiency, nuclear type 1 (1)
1	-	-	Mitochondrial complex IV deficiency, nuclear type 1 (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3
Mutation Taster		=93/107	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs863224229; hg19: chr9-136223316;