rs863224478

chr7-150958473-G-GCAGCTTCAGGCGGAAGGTCTTGGCGCGGC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000238.4(KCNH2):c.501_502insGCCGCGCCAAGACCTTCCGCCTGAAGCTG(p.Pro168AlafsTer8) variant causes a stop gained, frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KCNH2 NM_000238.4 stop_gained, frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.137

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-150958473-G-GCAGCTTCAGGCGGAAGGTCTTGGCGCGGC is Pathogenic according to our data. Variant chr7-150958473-G-GCAGCTTCAGGCGGAAGGTCTTGGCGCGGC is described in ClinVar as [Pathogenic]. Clinvar id is 216047.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
KCNH2	NM_000238.4	c.501_502insGCCGCGCCAAGACCTTCCGCCTGAAGCTG	p.Pro168AlafsTer8	stop_gained, frameshift_variant	4/15	ENST00000262186.10

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
KCNH2	ENST00000262186.10	c.501_502insGCCGCGCCAAGACCTTCCGCCTGAAGCTG	p.Pro168AlafsTer8	stop_gained, frameshift_variant	4/15	1	NM_000238.4	P1
KCNH2	ENST00000532957.5	n.724_725insGCCGCGCCAAGACCTTCCGCCTGAAGCTG		non_coding_transcript_exon_variant	4/9	2
KCNH2	ENST00000684241.1	n.1334_1335insGCCGCGCCAAGACCTTCCGCCTGAAGCTG		non_coding_transcript_exon_variant	2/13

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Long QT syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Invitae

Feb 18, 2015

For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, truncating variants in KCNH2 are known to be pathogenic (PMID: 10973849, 17576861). This sequence change inserts 29 nucleotide in exon 4 of the KCNH2 mRNA (c.473_501dupGCCGCGCCAAGACCTTCCGCCTGAAGCTG), causing a frameshift at codon 168. This creates a premature translational stop signal (p.Pro168Alafs*8) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs863224478; hg19: chr7-150655561;