rs863224478

Variant names:

• chr7-150958473-G-GCAGCTTCAGGCGGAAGGTCTTGGCGCGGC
• rs863224478
• NM_000238.4:c.473_501dupGCCGCGCCAAGACCTTCCGCCTGAAGCTG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000238.4(KCNH2):​c.473_501dupGCCGCGCCAAGACCTTCCGCCTGAAGCTG​(p.Pro168AlafsTer8) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KCNH2 NM_000238.4 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.137
• Publications: 1 publications found

Genes affected

KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

KCNH2 Gene-Disease associations (from GenCC):

• long QT syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• long QT syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• short QT syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• short QT syndrome type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Brugada syndrome

  Inheritance: AD Classification: MODERATE, NO_KNOWN Submitted by: ClinGen, Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-150958473-G-GCAGCTTCAGGCGGAAGGTCTTGGCGCGGC is Pathogenic according to our data. Variant chr7-150958473-G-GCAGCTTCAGGCGGAAGGTCTTGGCGCGGC is described in ClinVar as Pathogenic. ClinVar VariationId is 216047.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNH2	NM_000238.4	c.473_501dupGCCGCGCCAAGACCTTCCGCCTGAAGCTG	p.Pro168AlafsTer8	frameshift_variant, stop_gained	Exon 4 of 15	ENST00000262186.10	NP_000229.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNH2	ENST00000262186.10	c.473_501dupGCCGCGCCAAGACCTTCCGCCTGAAGCTG	p.Pro168AlafsTer8	frameshift_variant, stop_gained	Exon 4 of 15	1	NM_000238.4	ENSP00000262186.5

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Long QT syndrome Pathogenic:1

Feb 18, 2015

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

While this particular variant has not been reported in the literature, truncating variants in KCNH2 are known to be pathogenic (PMID: 10973849, 17576861). For these reasons, this variant has been classified as Pathogenic. This sequence change inserts 29 nucleotide in exon 4 of the KCNH2 mRNA (c.473_501dupGCCGCGCCAAGACCTTCCGCCTGAAGCTG), causing a frameshift at codon 168. This creates a premature translational stop signal (p.Pro168Alafs*8) and is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.14
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs863224478; hg19: chr7-150655561;