rs864321619

Variant names:

• chr13-28034125-T-TTCATATTCTCTGAAATCAACG
• rs864321619
• NM_004119.3:c.1773_1793dupCGTTGATTTCAGAGAATATGA

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP5_Moderate

The NM_004119.3(FLT3):​c.1773_1793dupCGTTGATTTCAGAGAATATGA​(p.Tyr597_Glu598insAspValAspPheArgGluTyr) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: FLT3 NM_004119.3 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.72
• Publications: 0 publications found

Genes affected

FLT3 (HGNC:3765): (fms related receptor tyrosine kinase 3) This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015]

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004119.3.
• PP5: Variant 13-28034125-T-TTCATATTCTCTGAAATCAACG is Pathogenic according to our data. Variant chr13-28034125-T-TTCATATTCTCTGAAATCAACG is described in ClinVar as Pathogenic. ClinVar VariationId is 219096.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004119.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FLT3	NM_004119.3	MANE Select	c.1773_1793dupCGTTGATTTCAGAGAATATGA	p.Tyr597_Glu598insAspValAspPheArgGluTyr	disruptive_inframe_insertion	Exon 14 of 24	NP_004110.2
	FLT3	NR_130706.2		n.1839_1859dupCGTTGATTTCAGAGAATATGA		non_coding_transcript_exon	Exon 14 of 25

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FLT3	ENST00000241453.12	TSL:1 MANE Select	c.1773_1793dupCGTTGATTTCAGAGAATATGA	p.Tyr597_Glu598insAspValAspPheArgGluTyr	disruptive_inframe_insertion	Exon 14 of 24	ENSP00000241453.7
	FLT3	ENST00000380987.2	TSL:1	n.1773_1793dupCGTTGATTTCAGAGAATATGA		non_coding_transcript_exon	Exon 14 of 25	ENSP00000370374.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Myelodysplastic syndrome progressed to acute myeloid leukemia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.7
Mutation Taster		=63/37	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs864321619; hg19: chr13-28608262; COSMIC: COSV54047546;