rs864321619

Positions:

• chr13-28034125-T-TTCATATTCTCTGAAATCAACG

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP5_Moderate

The NM_004119.3(FLT3):​c.1773_1793dupCGTTGATTTCAGAGAATATGA​(p.Tyr597_Glu598insAspValAspPheArgGluTyr) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: FLT3 NM_004119.3 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.72

Genes affected

FLT3 (HGNC:3765): (fms related receptor tyrosine kinase 3) This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015]

FLT3 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_004119.3.
• PP5: Variant 13-28034125-T-TTCATATTCTCTGAAATCAACG is Pathogenic according to our data. Variant chr13-28034125-T-TTCATATTCTCTGAAATCAACG is described in ClinVar as [Pathogenic]. Clinvar id is 219096.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FLT3	NM_004119.3	c.1773_1793dupCGTTGATTTCAGAGAATATGA	p.Tyr597_Glu598insAspValAspPheArgGluTyr	disruptive_inframe_insertion	14/24	ENST00000241453.12	NP_004110.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FLT3	ENST00000241453.12	c.1773_1793dupCGTTGATTTCAGAGAATATGA	p.Tyr597_Glu598insAspValAspPheArgGluTyr	disruptive_inframe_insertion	14/24	1	NM_004119.3	ENSP00000241453.7
FLT3	ENST00000380987.2	n.1773_1793dupCGTTGATTTCAGAGAATATGA		non_coding_transcript_exon_variant	14/25	1		ENSP00000370374.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Myelodysplastic syndrome progressed to acute myeloid leukemia Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Hospital of the University of Pennsylvania, Center for Personalized Diagnostics

Jan 08, 2016

This is a FLT3 internal tandem duplication(FLT3 ITD) which is associated with poor prognosis in AML with normal cytogenetics. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs864321619; hg19: chr13-28608262;