rs869312177

Variant names:

• chr4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG
• rs869312177
• NM_000283.4:c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG

Variant summary

Our verdict is Pathogenic. The variant received 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000283.4(PDE6B):​c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG​(p.Asn643GlyfsTer29) variant causes a frameshift, missense, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Another nucleotide change resulting in the same amino acid substitution has been previously reported as Pathogenic in ClinVar. Synonymous variant affecting the same amino acid position (i.e. T641T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: PDE6B NM_000283.4 frameshift, missense, splice_region
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 8.69

Genes affected

PDE6B (HGNC:8786): (phosphodiesterase 6B) Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]

ACMG classification

Our verdict: Pathogenic. The variant received 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG is Pathogenic according to our data. Variant chr4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 224742.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PDE6B	NM_000283.4	c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn643GlyfsTer29	frameshift_variant, missense_variant, splice_region_variant	Exon 16 of 22	ENST00000496514.6	NP_000274.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PDE6B	ENST00000496514.6	c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn643GlyfsTer29	frameshift_variant, missense_variant, splice_region_variant	Exon 16 of 22	1	NM_000283.4	ENSP00000420295.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:9

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Retinitis pigmentosa Pathogenic:3

Apr 01, 2018

Department of Clinical Genetics, Copenhagen University Hospital, Rigshospitalet

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Jan 01, 2015

NIHR Bioresource Rare Diseases, University of Cambridge

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Jan 09, 2020

Molecular Genetics Laboratory, Institute for Ophthalmic Research

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Retinitis pigmentosa 40 Pathogenic:3

Sep 01, 2016

Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Apr 08, 2021

Ocular Genomics Institute, Massachusetts Eye and Ear

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

The PDE6B c.1923_1969delinsTCTGGG variant was identified in an individual with retinitis pigmentosa with a presumed recessive inheritance pattern. Through a review of available evidence we were able to apply the following criteria: PVS1, PM2. Based on this evidence we have classified this variant as Likely Pathogenic. -

May 12, 2015

Centre for Genomic Medicine, Manchester, Central Manchester University Hospitals

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

not provided Pathogenic:2

Feb 10, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This premature translational stop signal has been observed in individual(s) with inherited autosomal recessive retinal disease (PMID: 26872967, 28041643). For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 224742). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Asn643Glyfs*29) in the PDE6B gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PDE6B are known to be pathogenic (PMID: 8394174, 8595886, 22334370). -

May 13, 2025

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25356970, 25999674, 28041643, 24828262) -

PDE6B-related disorder Pathogenic:1

Sep 11, 2024

PreventionGenetics, part of Exact Sciences

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The PDE6B c.1923_1969delinsTCTGGG variant is predicted to result in a frameshift and premature protein termination (p.Asn643Glyfs*29). This variant has been reported in the homozygous and compound heterozygous states in individuals with retinal disease (Shen et al. 2014. PubMed ID: 25377065; Table S2, Carss et al. 2016. PubMed ID: 28041643). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. Frameshift variants in PDE6B are an established mechanism of disease. This variant is interpreted as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs869312177; hg19: chr4-657561;