rs869312177

Variant names:

• chr4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG
• rs869312177
• NM_000283.4:c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000283.4(PDE6B):​c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG​(p.Asn643GlyfsTer29) variant causes a frameshift, missense, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T641T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: PDE6B NM_000283.4 frameshift, missense, splice_region
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 8.69
• Publications: 7 publications found

Genes affected

PDE6B (HGNC:8786): (phosphodiesterase 6B) Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]

PDE6B Gene-Disease associations (from GenCC):

• inherited retinal dystrophy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• retinitis pigmentosa 40

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, G2P
• congenital stationary night blindness autosomal dominant 2

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• congenital stationary night blindness

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• retinitis pigmentosa

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000272927 (HGNC:58704):

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG is Pathogenic according to our data. Variant chr4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 224742.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000283.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PDE6B	NM_000283.4	MANE Select	c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn643GlyfsTer29	frameshift missense splice_region	Exon 16 of 22	NP_000274.3	P35913-1
	PDE6B	NM_001440547.1		c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn643GlyfsTer29	frameshift missense splice_region	Exon 16 of 22	NP_001427476.1
	PDE6B	NM_001145291.2		c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn643GlyfsTer29	frameshift missense splice_region	Exon 16 of 22	NP_001138763.2	P35913-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PDE6B	ENST00000496514.6	TSL:1 MANE Select	c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn643GlyfsTer29	frameshift missense splice_region	Exon 16 of 22	ENSP00000420295.1	P35913-1
	PDE6B	ENST00000255622.10	TSL:1	c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn643GlyfsTer29	frameshift missense splice_region	Exon 16 of 22	ENSP00000255622.6	P35913-2
	PDE6B	ENST00000471824.6	TSL:5	c.3_49delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn3GlyfsTer29	frameshift missense	Exon 1 of 6	ENSP00000417852.2	H7C4P9

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	Retinitis pigmentosa (3)
3	-	-	Retinitis pigmentosa 40 (3)
2	-	-	not provided (2)
1	-	-	PDE6B-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs869312177; hg19: chr4-657561;