rs869312177

Positions:

• chr4-663771-CCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-CTCTGGG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000283.4(PDE6B):​c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG​(p.Asn643fs) variant causes a frameshift, missense, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Another nucleotide change resulting in same amino acid change has been previously reported as Pathogenicin Lovd. Synonymous variant affecting the same amino acid position (i.e. T641T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: PDE6B NM_000283.4 frameshift, missense, splice_region
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:9
• Conservation: PhyloP100: 8.69

Genes affected

PDE6B (HGNC:8786): (phosphodiesterase 6B) Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]

PDE6B (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG is Pathogenic according to our data. Variant chr4-663772-CCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGA-TCTGGG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 224742.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PDE6B	NM_000283.4	c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn643fs	frameshift_variant, missense_variant, splice_region_variant	16/22	ENST00000496514.6	NP_000274.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PDE6B	ENST00000496514.6	c.1923_1969delCCTGAACATCTACCAGAACCTGAACCGGCGGCAGCACGAGCACGTGAinsTCTGGG	p.Asn643fs	frameshift_variant, missense_variant, splice_region_variant	16/22	1	NM_000283.4	ENSP00000420295.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:9

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Retinitis pigmentosa Pathogenic:3

Pathogenic, criteria provided, single submitter	research	Molecular Genetics Laboratory, Institute for Ophthalmic Research	Jan 09, 2020	- -
Likely pathogenic, no assertion criteria provided	research	NIHR Bioresource Rare Diseases, University of Cambridge	Jan 01, 2015	- -
Likely pathogenic, no assertion criteria provided	research	Department of Clinical Genetics, Copenhagen University Hospital, Rigshospitalet	Apr 01, 2018	- -

Retinitis pigmentosa 40 Pathogenic:3

Likely pathogenic, criteria provided, single submitter	research	Ocular Genomics Institute, Massachusetts Eye and Ear	Apr 08, 2021	The PDE6B c.1923_1969delinsTCTGGG variant was identified in an individual with retinitis pigmentosa with a presumed recessive inheritance pattern. Through a review of available evidence we were able to apply the following criteria: PVS1, PM2. Based on this evidence we have classified this variant as Likely Pathogenic. -
Likely pathogenic, no assertion criteria provided	clinical testing	Centre for Genomic Medicine, Manchester, Central Manchester University Hospitals	May 12, 2015	- -
Pathogenic, no assertion criteria provided	clinical testing	Joint Genome Diagnostic Labs from Nijmegen and Maastricht, Radboudumc and MUMC+	Sep 01, 2016	- -

not provided Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	GeneDx	Sep 06, 2018	The c.1923_1969del47insTCTGGG variant in the PDE6B gene has been reported previously in association with autosomal recessive retinitis pigmentosa when present in the homozygous state or when present with another disease-causing PDE6B variant (Shen et al., 2014; Carss et al., 2017). This variant causes a frameshift starting with codon Asparagine 643, changes this amino acid to a Glycine residue, and creates a premature Stop codon at position 29 of the new reading frame, denoted p.Asn643GlyfsX29. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. This frameshift variant is not observed in large population cohorts (Lek et al., 2016). We interpret c.1923_1969del47insTCTGGG as a pathogenic variant. -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Feb 10, 2022	For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 224742). This premature translational stop signal has been observed in individual(s) with inherited autosomal recessive retinal disease (PMID: 26872967, 28041643). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Asn643Glyfs*29) in the PDE6B gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PDE6B are known to be pathogenic (PMID: 8394174, 8595886, 22334370). -

PDE6B-related disorder Pathogenic:1

Pathogenic, no assertion criteria provided

clinical testing

PreventionGenetics, part of Exact Sciences

Sep 11, 2024

The PDE6B c.1923_1969delinsTCTGGG variant is predicted to result in a frameshift and premature protein termination (p.Asn643Glyfs*29). This variant has been reported in the homozygous and compound heterozygous states in individuals with retinal disease (Shen et al. 2014. PubMed ID: 25377065; Table S2, Carss et al. 2016. PubMed ID: 28041643). This variant has not been reported in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. Frameshift variants in PDE6B are an established mechanism of disease. This variant is interpreted as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs869312177; hg19: chr4-657561;