rs869320627

Variant names:

• chr20-18057973-A-ACCGGTTCCGGCGGCCGGGGCTG
• rs869320627
• NM_001303461.1:c.-297+895_-297+916dupCAGCCCCGGCCGCCGGAACCGG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_001303461.1(OVOL2):​c.-297+895_-297+916dupCAGCCCCGGCCGCCGGAACCGG variant causes a intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: OVOL2 NM_001303461.1 intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 4.99
• Publications: 0 publications found

Genes affected

OVOL2 (HGNC:15804): (ovo like zinc finger 2) This gene encodes a member of the evolutionarily conserved ovo-like protein family. Mammalian members of this family contain a single zinc finger domain composed of a tetrad of C2H2 zinc fingers with variable N- and C-terminal extensions that contain intrinsically disordered domains. Members of this family are involved in epithelial development and differentiation. Knockout of this gene in mouse results in early embryonic lethality with phenotypes that include neurectoderm expansion, impaired vascularization, and heart anomalies. In humans, allelic variants of this gene have been associated with posterior polymorphous corneal dystrophy. [provided by RefSeq, Apr 2016]

OVOL2 Gene-Disease associations (from GenCC):

• posterior polymorphous corneal dystrophy 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
• congenital hereditary endothelial dystrophy type I

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• posterior polymorphous corneal dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 20-18057973-A-ACCGGTTCCGGCGGCCGGGGCTG is Pathogenic according to our data. Variant chr20-18057973-A-ACCGGTTCCGGCGGCCGGGGCTG is described in ClinVar as Pathogenic. ClinVar VariationId is 224837.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001303461.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	OVOL2	NM_001303461.1		c.-297+895_-297+916dupCAGCCCCGGCCGCCGGAACCGG		intron	N/A	NP_001290390.1
	OVOL2	NM_001303462.1		c.-76+1085_-76+1106dupCAGCCCCGGCCGCCGGAACCGG		intron	N/A	NP_001290391.1
	OVOL2	NM_021220.4	MANE Select	c.-361_-340dupCAGCCCCGGCCGCCGGAACCGG		upstream_gene	N/A	NP_067043.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	OVOL2	ENST00000483661.5	TSL:2	n.161+916_161+917insCAGCCCCGGCCGCCGGAACCGG		intron	N/A
	OVOL2	ENST00000486776.5	TSL:3	n.109+1106_109+1107insCAGCCCCGGCCGCCGGAACCGG		intron	N/A
	OVOL2	ENST00000494030.1	TSL:3	n.109+1106_109+1107insCAGCCCCGGCCGCCGGAACCGG		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Posterior polymorphous corneal dystrophy 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs869320627; hg19: chr20-18038617;