rs869320627
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5
The NM_001303461.1(OVOL2):c.-297+895_-297+916dupCAGCCCCGGCCGCCGGAACCGG variant causes a intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_001303461.1 intron
Scores
Clinical Significance
Conservation
Publications
- posterior polymorphous corneal dystrophy 1Inheritance: AD Classification: DEFINITIVE, STRONG, LIMITED Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- congenital hereditary endothelial dystrophy type IInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- posterior polymorphous corneal dystrophyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001303461.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| OVOL2 | c.-297+895_-297+916dupCAGCCCCGGCCGCCGGAACCGG | intron | N/A | NP_001290390.1 | Q9BRP0-2 | ||||
| OVOL2 | c.-76+1085_-76+1106dupCAGCCCCGGCCGCCGGAACCGG | intron | N/A | NP_001290391.1 | Q9BRP0-2 | ||||
| OVOL2 | MANE Select | c.-361_-340dupCAGCCCCGGCCGCCGGAACCGG | upstream_gene | N/A | NP_067043.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| OVOL2 | TSL:2 | n.161+916_161+917insCAGCCCCGGCCGCCGGAACCGG | intron | N/A | |||||
| OVOL2 | TSL:3 | n.109+1106_109+1107insCAGCCCCGGCCGCCGGAACCGG | intron | N/A | |||||
| OVOL2 | TSL:3 | n.109+1106_109+1107insCAGCCCCGGCCGCCGGAACCGG | intron | N/A |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at