rs876657397
Variant summary
Our verdict is Likely pathogenic. The variant received 7 ACMG points: 8P and 1B. PP5_Very_StrongBP3
The NM_000091.5(COL4A3):c.40_63delCTGCCGCTCCTGCTGGTGCTCCTG(p.Leu14_Leu21del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000557 in 1,525,760 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_000091.5 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Alport syndrome 3b, autosomal recessiveInheritance: AD, AR Classification: DEFINITIVE Submitted by: G2P
- autosomal recessive Alport syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, Myriad Women’s Health, Orphanet
- Alport syndromeInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- autosomal dominant Alport syndromeInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- hematuria, benign familial, 1Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 7 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000091.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A3 | NM_000091.5 | MANE Select | c.40_63delCTGCCGCTCCTGCTGGTGCTCCTG | p.Leu14_Leu21del | conservative_inframe_deletion | Exon 1 of 52 | NP_000082.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| COL4A3 | ENST00000396578.8 | TSL:1 MANE Select | c.40_63delCTGCCGCTCCTGCTGGTGCTCCTG | p.Leu14_Leu21del | conservative_inframe_deletion | Exon 1 of 52 | ENSP00000379823.3 |
Frequencies
GnomAD3 genomes AF: 0.0000197 AC: 3AN: 151956Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.000140 AC: 17AN: 121044 AF XY: 0.000165 show subpopulations
GnomAD4 exome AF: 0.0000597 AC: 82AN: 1373804Hom.: 0 AF XY: 0.0000694 AC XY: 47AN XY: 677680 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000197 AC: 3AN: 151956Hom.: 0 Cov.: 32 AF XY: 0.0000269 AC XY: 2AN XY: 74228 show subpopulations
Age Distribution
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at