rs876657685

Variant names:

• chrX-70027972-GGGACCACCTGGTCCTCCAGGTCCTCCTGGTCCTCAA-G
• rs876657685
• NM_001399.5:c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1 PM4 PP3 PP5_Very_Strong

The NM_001399.5(EDA):​c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC​(p.Pro217_Pro228del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 21)
• Consequence: EDA NM_001399.5 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 9.32
• Publications: 2 publications found

Genes affected

EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

EDA Gene-Disease associations (from GenCC):

• tooth agenesis, selective, X-linked, 1

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• X-linked hypohidrotic ectodermal dysplasia

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• tooth agenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 13 ACMG points.

• PM1: In a hotspot region, there are 12 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 4 uncertain in NM_001399.5
• PM4: Nonframeshift variant in NON repetitive region in NM_001399.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-70027972-GGGACCACCTGGTCCTCCAGGTCCTCCTGGTCCTCAA-G is Pathogenic according to our data. Variant chrX-70027972-GGGACCACCTGGTCCTCCAGGTCCTCCTGGTCCTCAA-G is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 228337.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001399.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EDA	NM_001399.5	MANE Select	c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC	p.Pro217_Pro228del	disruptive_inframe_deletion	Exon 4 of 8	NP_001390.1
	EDA	NM_001005609.2		c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC	p.Pro217_Pro228del	disruptive_inframe_deletion	Exon 4 of 8	NP_001005609.1
	EDA	NM_001440761.1		c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC	p.Pro217_Pro228del	disruptive_inframe_deletion	Exon 4 of 8	NP_001427690.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EDA	ENST00000374552.9	TSL:1 MANE Select	c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC	p.Pro217_Pro228del	disruptive_inframe_deletion	Exon 4 of 8	ENSP00000363680.4
	EDA	ENST00000374553.6	TSL:1	c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC	p.Pro217_Pro228del	disruptive_inframe_deletion	Exon 4 of 8	ENSP00000363681.2
	EDA	ENST00000524573.5	TSL:1	c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC	p.Pro217_Pro228del	disruptive_inframe_deletion	Exon 4 of 8	ENSP00000432585.1

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Hypohidrotic X-linked ectodermal dysplasia (2)
2	-	-	not provided (2)
1	-	-	EDA-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs876657685; hg19: chrX-69247822;