rs876657685

Variant names:

• chrX-70027972-GGGACCACCTGGTCCTCCAGGTCCTCCTGGTCCTCAA-G
• rs876657685
• NM_001399.5:c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1 PM4 PP3 PP5_Very_Strong

The NM_001399.5(EDA):​c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC​(p.Pro217_Pro228del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 21)
• Consequence: EDA NM_001399.5 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 9.32
• Publications: 2 publications found

Genes affected

EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

EDA Gene-Disease associations (from GenCC):

• tooth agenesis, selective, X-linked, 1

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• X-linked hypohidrotic ectodermal dysplasia

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• tooth agenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 13 ACMG points.

• PM1: In a hotspot region, there are 11 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 3 uncertain in NM_001399.5
• PM4: Nonframeshift variant in NON repetitive region in NM_001399.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant X-70027972-GGGACCACCTGGTCCTCCAGGTCCTCCTGGTCCTCAA-G is Pathogenic according to our data. Variant chrX-70027972-GGGACCACCTGGTCCTCCAGGTCCTCCTGGTCCTCAA-G is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 228337.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EDA	NM_001399.5	c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC	p.Pro217_Pro228del	disruptive_inframe_deletion	Exon 4 of 8	ENST00000374552.9	NP_001390.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EDA	ENST00000374552.9	c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC	p.Pro217_Pro228del	disruptive_inframe_deletion	Exon 4 of 8	1	NM_001399.5	ENSP00000363680.4

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hypohidrotic X-linked ectodermal dysplasia Pathogenic:2

Mar 04, 2015

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.Pro219_Gly230del variant in EDA has not been previously reported in indivi duals with XLHED. However, this variant results in an in-frame deletion of 11 am ino acids from the conserved Gly-X-Y repeat region of the collagen subdomain of the EDA protein. Several adjacent and overlapping in-frame and frameshift deleti ons have been identified in patients with clinical features of XLHED (Bayes 1998 , Cluzeau 2011, Zhang 2011, LMM unpublished data), indicating that this region i s intolerant to these types of variation. In summary, this variant meets our cri teria to be classified as pathogenic for hypohidrotic ectodermal dysplasia in an X-linked manner. -

Nov 15, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.648_683del, results in the deletion of 12 amino acid(s) of the EDA protein (p.Pro219_Gly230del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with ectodermal dysplasia (PMID: 29444360). ClinVar contains an entry for this variant (Variation ID: 228337). This variant disrupts a region of the EDA protein in which other variant(s) (p.Pro220_Pro225del) have been determined to be pathogenic (PMID: 9736768, 21357618, 27305980). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

not provided Pathogenic:2

Apr 04, 2020

Revvity Omics, Revvity

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Oct 17, 2017

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.648_683del36 deletion has not been reported previously in association with X-linked hypohidrotic ectodermal dysplasia (HED) to our knowledge. This in-frame deletion results in the deletion of 12 amino acids in the collagen-like domain of the ectodysplasin protein, beginning at Proline 219 and ending at Glycine 230, denoted p.Pro219_Gly230del. This variant is not expected to result in protein truncation or nonsense-mediated mRNA decay. An in-frame deletion beginning from the same position, c.648_665del18, has been published in the Human Gene Mutation Database in association with hypohidrotic ectodermal dysplasia. Therefore, the c.648_683del36 deletion is interpreted as a pathogenic variant. -

EDA-related disorder Pathogenic:1

Mar 13, 2024

PreventionGenetics, part of Exact Sciences

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The EDA c.648_683del36 variant is predicted to result in an in-frame deletion (p.Pro219_Gly230del). This variant has been reported in the hemizygous state in an individual with hypohidrotic ectodermal dysplasia (Feng et al. 2018. PubMed ID: 29444360). Alternate in-frame deletions in this same region have also been been reported in individuals with hypohidrotic ectodermal dysplasia (Wohlfart et al. 2020. PubMed ID: 31924237). This variant has not been reported in a large population database, indicating this variant is rare. This variant is interpreted as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs876657685; hg19: chrX-69247822;