rs876659260
Positions:
Variant summary
Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PM1PM2PM4PP3PP5_Moderate
The NM_000546.6(TP53):c.716_736delACAGTTCCTGCATGGGCGGCA(p.Asn239_Gly245del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Genomes: not found (cov: 30)
Consequence
TP53
NM_000546.6 disruptive_inframe_deletion
NM_000546.6 disruptive_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.32
Genes affected
TP53 (HGNC:11998): (tumor protein p53) This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 9 ACMG points.
PM1
In a region_of_interest Interaction with AXIN1 (size 176) in uniprot entity P53_HUMAN there are 53 pathogenic changes around while only 3 benign (95%) in NM_000546.6
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000546.6.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 17-7674226-ATGCCGCCCATGCAGGAACTGT-A is Pathogenic according to our data. Variant chr17-7674226-ATGCCGCCCATGCAGGAACTGT-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 231606.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TP53 | NM_000546.6 | c.716_736delACAGTTCCTGCATGGGCGGCA | p.Asn239_Gly245del | disruptive_inframe_deletion | 7/11 | ENST00000269305.9 | NP_000537.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TP53 | ENST00000269305.9 | c.716_736delACAGTTCCTGCATGGGCGGCA | p.Asn239_Gly245del | disruptive_inframe_deletion | 7/11 | 1 | NM_000546.6 | ENSP00000269305.4 |
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD3 genomes
Cov.:
30
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 30
GnomAD4 genome
Cov.:
30
ClinVar
Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Hereditary cancer-predisposing syndrome Pathogenic:1
Likely pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Jun 04, 2015 | The c.716_736del21 variant (also known as p.N239_G245del) is located in coding exon 6 of the TP53 gene. This variant results from an in-frame 21 nucleotide deletion between nucleotide positions 716 and 736 resulting in the deletion of codons 239 through 245 of the p53 protein. The seven nucleotides included in this deletion are involved in important aspects of p53 function and stability including DNA binding and zinc binding (Martin AC, Hum. Mutat. 2002 Feb; 19(2):149-64). Using a prediction software that analyzes the effect of small deletions, PROVEAN, this alteration was predicted to be highly deleterious (Choi Y, PLoS ONE 2012 ; 7(10):e46688). This variant was not reported in population based cohorts in the following databases: Database of Single Nucleotide Polymorphisms (dbSNP), NHLBI Exome Sequencing Project (ESP), and 1000 Genomes Project. In the ESP, this variant was not observed in 6503 samples (13006 alleles) with coverage at this position. Based on the majority of available evidence to date, this variant is likely to be pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at