rs876659260
Variant summary
Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1PM4PP3PP5_Moderate
The NM_000546.6(TP53):c.716_736delACAGTTCCTGCATGGGCGGCA(p.Asn239_Gly245del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. N239N) has been classified as Likely benign.
Frequency
Consequence
NM_000546.6 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- breast cancerInheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
- Li-Fraumeni syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, G2P, Labcorp Genetics (formerly Invitae), Orphanet
- Li-Fraumeni syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
- adrenocortical carcinoma, hereditaryInheritance: AD Classification: STRONG Submitted by: Ambry Genetics
- sarcomaInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- bone marrow failure syndrome 5Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- colorectal cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- choroid plexus carcinomaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 7 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000546.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TP53 | MANE Select | c.716_736delACAGTTCCTGCATGGGCGGCA | p.Asn239_Gly245del | disruptive_inframe_deletion | Exon 7 of 11 | NP_000537.3 | |||
| TP53 | c.716_736delACAGTTCCTGCATGGGCGGCA | p.Asn239_Gly245del | disruptive_inframe_deletion | Exon 7 of 11 | NP_001119584.1 | K7PPA8 | |||
| TP53 | c.716_736delACAGTTCCTGCATGGGCGGCA | p.Asn239_Gly245del | disruptive_inframe_deletion | Exon 8 of 12 | NP_001394191.1 | K7PPA8 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TP53 | TSL:1 MANE Select | c.716_736delACAGTTCCTGCATGGGCGGCA | p.Asn239_Gly245del | disruptive_inframe_deletion | Exon 7 of 11 | ENSP00000269305.4 | P04637-1 | ||
| TP53 | TSL:1 | c.716_736delACAGTTCCTGCATGGGCGGCA | p.Asn239_Gly245del | disruptive_inframe_deletion | Exon 7 of 11 | ENSP00000391478.2 | P04637-1 | ||
| TP53 | TSL:1 | c.599_619delACAGTTCCTGCATGGGCGGCA | p.Asn200_Gly206del | disruptive_inframe_deletion | Exon 6 of 10 | ENSP00000478219.1 | P04637-4 |
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD4 genome Cov.: 30
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at