rs876659260

Variant names:

• chr17-7674226-ATGCCGCCCATGCAGGAACTGT-A
• rs876659260
• NM_000546.6:c.716_736delACAGTTCCTGCATGGGCGGCA

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1 PM4 PP3 PP5_Moderate

The NM_000546.6(TP53):​c.716_736delACAGTTCCTGCATGGGCGGCA​(p.Asn239_Gly245del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. N239N) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 30)
• Consequence: TP53 NM_000546.6 disruptive_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.32
• Publications: 2 publications found

Genes affected

TP53 (HGNC:11998): (tumor protein p53) This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]

TP53 Gene-Disease associations (from GenCC):

• breast cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
• Li-Fraumeni syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet
• Li-Fraumeni syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
• adrenocortical carcinoma, hereditary

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics
• sarcoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• bone marrow failure syndrome 5

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• colorectal cancer

  Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
• choroid plexus carcinoma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

• PM1: In a hotspot region, there are 63 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 2 benign, 28 uncertain in NM_000546.6
• PM4: Nonframeshift variant in NON repetitive region in NM_000546.6.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 17-7674226-ATGCCGCCCATGCAGGAACTGT-A is Pathogenic according to our data. Variant chr17-7674226-ATGCCGCCCATGCAGGAACTGT-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 231606.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TP53	NM_000546.6	c.716_736delACAGTTCCTGCATGGGCGGCA	p.Asn239_Gly245del	disruptive_inframe_deletion	Exon 7 of 11	ENST00000269305.9	NP_000537.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TP53	ENST00000269305.9	c.716_736delACAGTTCCTGCATGGGCGGCA	p.Asn239_Gly245del	disruptive_inframe_deletion	Exon 7 of 11	1	NM_000546.6	ENSP00000269305.4

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Jun 04, 2015

Ambry Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.716_736del21 variant (also known as p.N239_G245del) is located in coding exon 6 of the TP53 gene. This variant results from an in-frame 21 nucleotide deletion between nucleotide positions 716 and 736 resulting in the deletion of codons 239 through 245 of the p53 protein. The seven nucleotides included in this deletion are involved in important aspects of p53 function and stability including DNA binding and zinc binding (Martin AC, Hum. Mutat. 2002 Feb; 19(2):149-64). Using a prediction software that analyzes the effect of small deletions, PROVEAN, this alteration was predicted to be highly deleterious (Choi Y, PLoS ONE 2012 ; 7(10):e46688). This variant was not reported in population based cohorts in the following databases: Database of Single Nucleotide Polymorphisms (dbSNP), NHLBI Exome Sequencing Project (ESP), and 1000 Genomes Project. In the ESP, this variant was not observed in 6503 samples (13006 alleles) with coverage at this position. Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs876659260; hg19: chr17-7577544;