rs876661296

Variant names:

• chr5-177386231-GGTCCCCAAGCTGCGCCAGGCT-G
• rs876661296
• NM_003052.5:c.272_292delTCCCCAAGCTGCGCCAGGCTG

Your query was ambiguous. Multiple possible variants found:

• chr5-177386231-GGTCCCCAAGCTGCGCCAGGCT-G
• chr5-177386231-GGTCCCCAAGCTGCGCCAGGCT-GGTCCCCAAGCTGCGCCAGGCTGTCCCCAAGCTGCGCCAGGCT

Variant summary

Our verdict is Likely benign. Variant got -6 ACMG points: 2P and 8B. PM4 BS1 BS2

The NM_003052.5(SLC34A1):​c.272_292delTCCCCAAGCTGCGCCAGGCTG​(p.Val91_Ala97del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.022 in 1,614,122 control chromosomes in the GnomAD database, including 439 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.017 (24 hom., cov: 32)
  • Exomes 𝑓: 0.023 (415 hom.)
• Consequence: SLC34A1 NM_003052.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:3 U:2 B:4
• Conservation: PhyloP100: 2.59

Genes affected

SLC34A1 (HGNC:11019): (solute carrier family 34 member 1) Enables sodium:phosphate symporter activity. Involved in several processes, including phosphate ion homeostasis; phosphate ion transport; and response to lead ion. Located in several cellular components, including apical plasma membrane; mitotic spindle; and nuclear speck. Implicated in several diseases, including Fanconi syndrome (multiple); chronic kidney disease; hereditary hypophosphatemic rickets with hypercalciuria; hypophosphatemic nephrolithiasis/osteoporosis 1; and nephrolithiasis. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_benign. Variant got -6 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003052.5.
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.0171 (2599/152316) while in subpopulation NFE AF= 0.0266 (1808/68014). AF 95% confidence interval is 0.0256. There are 24 homozygotes in gnomad4. There are 1263 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 24 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC34A1	NM_003052.5	c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 13	ENST00000324417.6	NP_003043.3
SLC34A1	NM_001167579.2	c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 9		NP_001161051.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC34A1	ENST00000324417.6	c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 13	1	NM_003052.5	ENSP00000321424.4
SLC34A1	ENST00000512593.5	c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 9	2		ENSP00000423022.1
SLC34A1	ENST00000504577.5	c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 4	4		ENSP00000423733.1
SLC34A1	ENST00000507685.5	n.356_376delTCCCCAAGCTGCGCCAGGCTG		non_coding_transcript_exon_variant	Exon 4 of 10	2

Frequencies

GnomAD3 genomes AF: 0.0171 AC: 2600 AN: 152198 Hom.: 24 Cov.: 32

Gnomad AFR AF: 0.00463

Gnomad AMI AF: 0.0307

Gnomad AMR AF: 0.00988

Gnomad ASJ AF: 0.0104

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00807

Gnomad FIN AF: 0.0305

Gnomad MID AF: 0.00949

Gnomad NFE AF: 0.0266

Gnomad OTH AF: 0.00908

GnomAD3 exomes AF: 0.0168 AC: 4220 AN: 251174 Hom.: 36 AF XY: 0.0169 AC XY: 2294 AN XY: 135770

Gnomad AFR exome AF: 0.00388

Gnomad AMR exome AF: 0.00541

Gnomad ASJ exome AF: 0.00914

Gnomad EAS exome AF: 0.000109

Gnomad SAS exome AF: 0.0103

Gnomad FIN exome AF: 0.0278

Gnomad NFE exome AF: 0.0253

Gnomad OTH exome AF: 0.0140

GnomAD4 exome AF: 0.0225 AC: 32895 AN: 1461806 Hom.: 415 AF XY: 0.0223 AC XY: 16228 AN XY: 727212

Gnomad4 AFR exome AF: 0.00346

Gnomad4 AMR exome AF: 0.00570

Gnomad4 ASJ exome AF: 0.00884

Gnomad4 EAS exome AF: 0.0000252

Gnomad4 SAS exome AF: 0.0106

Gnomad4 FIN exome AF: 0.0285

Gnomad4 NFE exome AF: 0.0258

Gnomad4 OTH exome AF: 0.0189

GnomAD4 genome AF: 0.0171 AC: 2599 AN: 152316 Hom.: 24 Cov.: 32 AF XY: 0.0170 AC XY: 1263 AN XY: 74482

Gnomad4 AFR AF: 0.00462

Gnomad4 AMR AF: 0.00986

Gnomad4 ASJ AF: 0.0104

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00787

Gnomad4 FIN AF: 0.0305

Gnomad4 NFE AF: 0.0266

Gnomad4 OTH AF: 0.00899

Alfa AF: 0.0192 Hom.: 4

Bravo AF: 0.0143

Asia WGS AF: 0.00289 AC: 10 AN: 3478

EpiCase AF: 0.0211

EpiControl AF: 0.0219

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:3 Uncertain:2 Benign:4

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hypercalcemia, infantile, 2 Pathogenic:3 Uncertain:1

Jan 31, 2021

MK Azim Lab, Mohammad Ali Jinnah University

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Oct 06, 2016

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Mar 08, 2024

Molecular Genetics Laboratory, Biobizkaia Health Research Institute

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Jan 06, 2020

Reproductive Health Research and Development, BGI Genomics

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

NM_003052.4:c.272_292del in the SLC34A1 gene has an allele frequency of 0.025 in European (non-Finnish) subpopulation in the gnomAD database, including 41 homozygous occurrences. However, considering the prevalence of hypercalcemia in the general population is approximately 1% to 2% (NCBI Bookshelf, Hypercalcemia), and it is not lethal, we decided not to take the allele frequency as a strong benign evidence. This variant was identified in homozygous state in a girl who presented with incidental nephrocalcinosis and polyuria (PMID: 26047794). Functional analyses confirmed the impaired trafficking of NaPi-IIa-91del7 in HEK293 cells while phosphate uptake in the Xenopus oocyte system was largely preserved (PMID: 26047794). We interpret it as Pathogenic/Likely pathogenic. ACMG/AMP criteria applied: PS3, PM3, PM4. -

not provided Uncertain:1 Benign:3

Feb 03, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Jan 11, 2023

Mayo Clinic Laboratories, Mayo Clinic

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

BS2, PM3, PM4, PS3_supporting, PS4_moderate -

Mar 01, 2025

CeGaT Center for Human Genetics Tuebingen

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

SLC34A1: BS1, BS2 -

Feb 01, 2019

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is associated with the following publications: (PMID: 26047794, 29959532, 25296721, 16688119, 27378183, 28470390) -

Hypophosphatemic nephrolithiasis/osteoporosis 1;C3150652:Fanconi renotubular syndrome 2;C4310473:Hypercalcemia, infantile, 2 Benign:1

Oct 27, 2021

Fulgent Genetics, Fulgent Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs876661296; hg19: chr5-176813232;