rs876661296

Variant names:

• chr5-177386231-GGTCCCCAAGCTGCGCCAGGCT-G
• rs876661296
• NM_003052.5:c.272_292delTCCCCAAGCTGCGCCAGGCTG

Your query was ambiguous. Multiple possible variants found:

• chr5-177386231-GGTCCCCAAGCTGCGCCAGGCT-G
• chr5-177386231-GGTCCCCAAGCTGCGCCAGGCT-GGTCCCCAAGCTGCGCCAGGCTGTCCCCAAGCTGCGCCAGGCT

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 6P and 5B. PS3 PM4 BS1_Supporting BS2

The NM_003052.5(SLC34A1):​c.272_292delTCCCCAAGCTGCGCCAGGCTG​(p.Val91_Ala97del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.022 in 1,614,122 control chromosomes in the GnomAD database, including 439 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). ClinVar reports functional evidence for this variant: "SCV001142351: Functional analyses confirmed the impaired trafficking of NaPi-IIa-91del7 in HEK293 cells while phosphate uptake in the Xenopus oocyte system was largely preserved (PMID:26047794).".

• Frequency:
  • Genomes: 𝑓 0.017 (24 hom., cov: 32)
  • Exomes 𝑓: 0.023 (415 hom.)
• Consequence: SLC34A1 NM_003052.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:4 U:4 B:4
• Conservation: PhyloP100: 2.59
• Publications: 8 publications found

Genes affected

SLC34A1 (HGNC:11019): (solute carrier family 34 member 1) Enables sodium:phosphate symporter activity. Involved in several processes, including phosphate ion homeostasis; phosphate ion transport; and response to lead ion. Located in several cellular components, including apical plasma membrane; mitotic spindle; and nuclear speck. Implicated in several diseases, including Fanconi syndrome (multiple); chronic kidney disease; hereditary hypophosphatemic rickets with hypercalciuria; hypophosphatemic nephrolithiasis/osteoporosis 1; and nephrolithiasis. [provided by Alliance of Genome Resources, Apr 2022]

SLC34A1 Gene-Disease associations (from GenCC):

• hypercalcemia, infantile, 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, PanelApp Australia, Labcorp Genetics (formerly Invitae), ClinGen
• hypophosphatemic nephrolithiasis/osteoporosis 1

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• dominant hypophosphatemia with nephrolithiasis or osteoporosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• primary Fanconi syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive infantile hypercalcemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Fanconi renotubular syndrome 2

  Inheritance: AR Classification: LIMITED, NO_KNOWN Submitted by: Labcorp Genetics (formerly Invitae), ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV001142351: Functional analyses confirmed the impaired trafficking of NaPi-IIa-91del7 in HEK293 cells while phosphate uptake in the Xenopus oocyte system was largely preserved (PMID: 26047794).
• PM4: Nonframeshift variant in NON repetitive region in NM_003052.5.
• BS1: Variant frequency is greater than expected in population nfe. GnomAd4 allele frequency = 0.0171 (2599/152316) while in subpopulation NFE AF = 0.0266 (1808/68014). AF 95% confidence interval is 0.0256. There are 24 homozygotes in GnomAd4. There are 1263 alleles in the male GnomAd4 subpopulation. Median coverage is 32. This position passed quality control check. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High Homozygotes in GnomAd4 at 24 AR,AD gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003052.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC34A1	NM_003052.5	MANE Select	c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 13	NP_003043.3
	SLC34A1	NM_001167579.2		c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 9	NP_001161051.1	Q06495-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC34A1	ENST00000324417.6	TSL:1 MANE Select	c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 13	ENSP00000321424.4	Q06495-1
	SLC34A1	ENST00000872468.1		c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 13	ENSP00000542527.1
	SLC34A1	ENST00000512593.5	TSL:2	c.272_292delTCCCCAAGCTGCGCCAGGCTG	p.Val91_Ala97del	disruptive_inframe_deletion	Exon 4 of 9	ENSP00000423022.1	Q06495-2

Frequencies

GnomAD3 genomes AF: 0.0171 AC: 2600 AN: 152198 Hom.: 24 Cov.: 32

Gnomad AFR AF: 0.00463

Gnomad AMI AF: 0.0307

Gnomad AMR AF: 0.00988

Gnomad ASJ AF: 0.0104

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00807

Gnomad FIN AF: 0.0305

Gnomad MID AF: 0.00949

Gnomad NFE AF: 0.0266

Gnomad OTH AF: 0.00908

GnomAD2 exomes AF: 0.0168 AC: 4220 AN: 251174 AF XY: 0.0169

Gnomad AFR exome AF: 0.00388

Gnomad AMR exome AF: 0.00541

Gnomad ASJ exome AF: 0.00914

Gnomad EAS exome AF: 0.000109

Gnomad FIN exome AF: 0.0278

Gnomad NFE exome AF: 0.0253

Gnomad OTH exome AF: 0.0140

GnomAD4 exome AF: 0.0225 AC: 32895 AN: 1461806 Hom.: 415 AF XY: 0.0223 AC XY: 16228 AN XY: 727212

African (AFR) AF: 0.00346 AC: 116 AN: 33480

American (AMR) AF: 0.00570 AC: 255 AN: 44722

Ashkenazi Jewish (ASJ) AF: 0.00884 AC: 231 AN: 26136

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39700

South Asian (SAS) AF: 0.0106 AC: 910 AN: 86254

European-Finnish (FIN) AF: 0.0285 AC: 1519 AN: 53390

Middle Eastern (MID) AF: 0.00693 AC: 40 AN: 5768

European-Non Finnish (NFE) AF: 0.0258 AC: 28680 AN: 1111964

Other (OTH) AF: 0.0189 AC: 1143 AN: 60392

GnomAD4 genome AF: 0.0171 AC: 2599 AN: 152316 Hom.: 24 Cov.: 32 AF XY: 0.0170 AC XY: 1263 AN XY: 74482

African (AFR) AF: 0.00462 AC: 192 AN: 41574

American (AMR) AF: 0.00986 AC: 151 AN: 15308

Ashkenazi Jewish (ASJ) AF: 0.0104 AC: 36 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5180

South Asian (SAS) AF: 0.00787 AC: 38 AN: 4828

European-Finnish (FIN) AF: 0.0305 AC: 324 AN: 10622

Middle Eastern (MID) AF: 0.0102 AC: 3 AN: 294

European-Non Finnish (NFE) AF: 0.0266 AC: 1808 AN: 68014

Other (OTH) AF: 0.00899 AC: 19 AN: 2114

Alfa AF: 0.0192 Hom.: 4

Bravo AF: 0.0143

Asia WGS AF: 0.00289 AC: 10 AN: 3478

EpiCase AF: 0.0211

EpiControl AF: 0.0219

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
4	1	1	Hypercalcemia, infantile, 2 (6)
-	2	2	not provided (4)
-	1	1	Hypophosphatemic nephrolithiasis/osteoporosis 1;C3150652:Fanconi renotubular syndrome 2;C4310473:Hypercalcemia, infantile, 2 (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.6
Mutation Taster		=166/34	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs876661296; hg19: chr5-176813232; COSMIC: COSV60995769; COSMIC: COSV60995769;