rs878853252

Variant names:

• chr1-8361236-C-CCCTGGAGGAGCTGAGGAGGGAG
• rs878853252
• NM_001042681.2:c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001042681.2(RERE):​c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG​(p.Thr758SerfsTer36) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: RERE NM_001042681.2 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.76
• Publications: 0 publications found

Genes affected

RERE (HGNC:9965): (arginine-glutamic acid dipeptide repeats) This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

RERE Gene-Disease associations (from GenCC):

• complex neurodevelopmental disorder with or without congenital anomalies

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• neurodevelopmental disorder with or without anomalies of the brain, eye, or heart

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae), G2P

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 1-8361236-C-CCCTGGAGGAGCTGAGGAGGGAG is Pathogenic according to our data. Variant chr1-8361236-C-CCCTGGAGGAGCTGAGGAGGGAG is described in ClinVar as Pathogenic. ClinVar VariationId is 236219.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001042681.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RERE	NM_001042681.2	MANE Select	c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr758SerfsTer36	frameshift	Exon 18 of 23	NP_001036146.1
	RERE	NM_012102.4		c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr758SerfsTer36	frameshift	Exon 19 of 24	NP_036234.3
	RERE	NM_001042682.2		c.587_608dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr204SerfsTer36	frameshift	Exon 8 of 13	NP_001036147.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RERE	ENST00000400908.7	TSL:1 MANE Select	c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr758SerfsTer36	frameshift	Exon 18 of 23	ENSP00000383700.2
	RERE	ENST00000337907.7	TSL:1	c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr758SerfsTer36	frameshift	Exon 19 of 24	ENSP00000338629.3
	RERE	ENST00000476556.5	TSL:1	c.587_608dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr204SerfsTer36	frameshift	Exon 8 of 13	ENSP00000422246.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart Pathogenic:1

Jan 08, 2018

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.8
Mutation Taster		=3/197	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs878853252; hg19: chr1-8421296;