rs878854272

Variant names:

• chr2-202530950-GCGAGGTGAGTGTATACAAAA-G
• rs878854272
• NM_001204.7:c.1125_1128+16delCGAGGTGAGTGTATACAAAA

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001204.7(BMPR2):​c.1125_1128+16delCGAGGTGAGTGTATACAAAA​(p.Ser375ArgfsTer17) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: BMPR2 NM_001204.7 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 9.93

Genes affected

BMPR2 (HGNC:1078): (bone morphogenetic protein receptor type 2) This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq, May 2020]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-202530950-GCGAGGTGAGTGTATACAAAA-G is Pathogenic according to our data. Variant chr2-202530950-GCGAGGTGAGTGTATACAAAA-G is described in ClinVar as [Pathogenic]. Clinvar id is 238628.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BMPR2	NM_001204.7	c.1125_1128+16delCGAGGTGAGTGTATACAAAA	p.Ser375ArgfsTer17	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 8 of 13	ENST00000374580.10	NP_001195.2
BMPR2	XM_011511687.2	c.1125_1128+16delCGAGGTGAGTGTATACAAAA	p.Ser375ArgfsTer17	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 8 of 13		XP_011509989.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BMPR2	ENST00000374580.10	c.1125_1128+16delCGAGGTGAGTGTATACAAAA	p.Ser375ArgfsTer17	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 8 of 13	1	NM_001204.7	ENSP00000363708.4
BMPR2	ENST00000374574.2	c.1125_1128+16delCGAGGTGAGTGTATACAAAA	p.Ser375ArgfsTer17	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 8 of 12	2		ENSP00000363702.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Primary pulmonary hypertension Pathogenic:1

Nov 19, 2015

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change deletes the last  4 nucleotides from exon 8 and the first 16 nucleotides from intron 8 of the BMPR2 mRNA (c.1125_1128+16delCGAGGTGAGTGTATACAAAA), causing a frameshift at codon 375. This creates a premature translational stop signal (p.Ser375Argfs*13). This deletion also includes the donor splice site in intron 8. Skipping of exon 8 would also result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in BMPR2 are known to be pathogenic (PMID: 16429395, 20534176). For these reasons, this variant has been classified as Pathogenic. -

Pulmonary hypertension, primary, 1 Pathogenic:1

Nov 19, 2015

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change deletes the last 4 nucleotides from exon 8 and the first 16 nucleotides from intron 8 of the BMPR2 mRNA (c.1125_1128+16delCGAGGTGAGTGTATACAAAA), causing a frameshift at codon 375. This creates a premature translational stop signal (p.Ser375Argfs*13). This deletion also includes the donor splice site in intron 8. Skipping of exon 8 would also result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in BMPR2 are known to be pathogenic (PMID: 16429395, 20534176). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs878854272; hg19: chr2-203395673;