rs878855029

Variant names:

• chr19-49182771-CCAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCT-C
• rs878855029
• NM_017636.4:c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC

Variant summary

Our verdict is Likely benign. Variant got -3 ACMG points: 2P and 5B. PM4 BP6 BS2

The NM_017636.4(TRPM4):​c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC​(p.Lys487_Leu498del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0113 in 1,614,016 control chromosomes in the GnomAD database, including 138 homozygotes. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0073 (5 hom., cov: 32)
  • Exomes 𝑓: 0.012 (133 hom.)
• Consequence: TRPM4 NM_017636.4 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:7
• Conservation: PhyloP100: 1.85

Genes affected

TRPM4 (HGNC:17993): (transient receptor potential cation channel subfamily M member 4) The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]

ACMG classification

Verdict is Likely_benign. Variant got -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017636.4.
• BP6: Variant 19-49182771-CCAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCT-C is Benign according to our data. Variant chr19-49182771-CCAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCT-C is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 241175.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=2, Benign=4, Uncertain_significance=1}. Variant chr19-49182771-CCAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCT-C is described in Lovd as [Benign].
• BS2: High AC in GnomAd4 at 1110 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TRPM4	NM_017636.4	c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC	p.Lys487_Leu498del	conservative_inframe_deletion	Exon 11 of 25	ENST00000252826.10	NP_060106.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TRPM4	ENST00000252826.10	c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC	p.Lys487_Leu498del	conservative_inframe_deletion	Exon 11 of 25	1	NM_017636.4	ENSP00000252826.4

Frequencies

GnomAD3 genomes AF: 0.00730 AC: 1111 AN: 152242 Hom.: 5 Cov.: 32

Gnomad AFR AF: 0.00200

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00379

Gnomad ASJ AF: 0.0144

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00971

Gnomad FIN AF: 0.00405

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0120

Gnomad OTH AF: 0.00622

GnomAD3 exomes AF: 0.00784 AC: 1944 AN: 247918 Hom.: 10 AF XY: 0.00792 AC XY: 1066 AN XY: 134562

Gnomad AFR exome AF: 0.00177

Gnomad AMR exome AF: 0.00602

Gnomad ASJ exome AF: 0.0146

Gnomad EAS exome AF: 0.000109

Gnomad SAS exome AF: 0.00608

Gnomad FIN exome AF: 0.00333

Gnomad NFE exome AF: 0.0111

Gnomad OTH exome AF: 0.0113

GnomAD4 exome AF: 0.0117 AC: 17131 AN: 1461656 Hom.: 133 AF XY: 0.0116 AC XY: 8425 AN XY: 727134

Gnomad4 AFR exome AF: 0.00140

Gnomad4 AMR exome AF: 0.00657

Gnomad4 ASJ exome AF: 0.0147

Gnomad4 EAS exome AF: 0.0000756

Gnomad4 SAS exome AF: 0.00665

Gnomad4 FIN exome AF: 0.00456

Gnomad4 NFE exome AF: 0.0134

Gnomad4 OTH exome AF: 0.0112

GnomAD4 genome AF: 0.00729 AC: 1110 AN: 152360 Hom.: 5 Cov.: 32 AF XY: 0.00695 AC XY: 518 AN XY: 74508

Gnomad4 AFR AF: 0.00200

Gnomad4 AMR AF: 0.00379

Gnomad4 ASJ AF: 0.0144

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00972

Gnomad4 FIN AF: 0.00405

Gnomad4 NFE AF: 0.0120

Gnomad4 OTH AF: 0.00616

Alfa AF: 0.0108 Hom.: 3

Bravo AF: 0.00688

Asia WGS AF: 0.00346 AC: 12 AN: 3478

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:7

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Benign:2

Oct 03, 2023

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Dec 27, 2019

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Brugada syndrome Uncertain:1

Nov 16, 2016

Center For Human Genetics And Laboratory Diagnostics, Dr. Klein, Dr. Rost And Colleagues

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not specified Benign:1

Aug 21, 2023

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: TRPM4 c.1459_1494del36 (p.Lys487_Leu498del) results in an in-frame deletion that is predicted to remove twelve amino acids from the encoded protein. The variant allele was found at a frequency of 0.0078 in 247918 control chromosomes, predominantly at a frequency of 0.011 within the Non-Finnish European subpopulation in the gnomAD database, including 3 homozygotes. The observed variant frequency within Non-Finnish European control individuals in the gnomAD database is approximately 4399.99 fold of the estimated maximal expected allele frequency for a pathogenic variant in TRPM4 causing Progressive Familial Heart Block Type 1B phenotype (2.5e-06), strongly suggesting that the variant is a benign polymorphism found primarily in populations of Non-Finnish European origin. c.1459_1494del36 has been reported in the literature as a polymorphism, and in a patient with a pathogenic variant explaining their phenotype (Syam_2016, Neubauer_2021). To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 27207958, 33895855). Six submitters have cited clinical-significance assessments for this variant to ClinVar after 2014: five classified the variant as likely benign while one classified as VUS. Based on the evidence outlined above, the variant was classified as benign. -

Cardiomyopathy Benign:1

Sep 08, 2017

Center for Advanced Laboratory Medicine, UC San Diego Health, University of California San Diego

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

TRPM4-related disorder Benign:1

Feb 17, 2020

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Progressive familial heart block type IB Benign:1

Jan 31, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Cardiovascular phenotype Benign:1

Jun 08, 2016

Ambry Genetics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs878855029; hg19: chr19-49686028;