rs878855029

Variant names:

• chr19-49182771-CCAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCT-C
• rs878855029
• NM_017636.4:c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC

Variant summary

Our verdict is Likely benign. The variant received -3 ACMG points: 2P and 5B. PM4 BP6 BS2

The NM_017636.4(TRPM4):​c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC​(p.Lys487_Leu498del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0113 in 1,614,016 control chromosomes in the GnomAD database, including 138 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.0073 (5 hom., cov: 32)
  • Exomes 𝑓: 0.012 (133 hom.)
• Consequence: TRPM4 NM_017636.4 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:8
• Conservation: PhyloP100: 1.85
• Publications: 1 publications found

Genes affected

TRPM4 (HGNC:17993): (transient receptor potential cation channel subfamily M member 4) The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]

TRPM4 Gene-Disease associations (from GenCC):

• erythrokeratodermia variabilis et progressiva 6

  Inheritance: AD Classification: STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• progressive familial heart block type IB

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• erythrokeratodermia variabilis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• progressive familial heart block

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Brugada syndrome

  Inheritance: AD Classification: LIMITED, NO_KNOWN Submitted by: Genomics England PanelApp, ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_017636.4.
• BP6: Variant 19-49182771-CCAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCT-C is Benign according to our data. Variant chr19-49182771-CCAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCT-C is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 241175.
• BS2: High AC in GnomAd4 at 1110 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_017636.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TRPM4	NM_017636.4	MANE Select	c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC	p.Lys487_Leu498del	conservative_inframe_deletion	Exon 11 of 25	NP_060106.2
	TRPM4	NM_001321281.2		c.1114_1149delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC	p.Lys372_Leu383del	conservative_inframe_deletion	Exon 9 of 23	NP_001308210.1
	TRPM4	NM_001195227.2		c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC	p.Lys487_Leu498del	conservative_inframe_deletion	Exon 11 of 24	NP_001182156.1	Q8TD43-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TRPM4	ENST00000252826.10	TSL:1 MANE Select	c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC	p.Lys487_Leu498del	conservative_inframe_deletion	Exon 11 of 25	ENSP00000252826.4	Q8TD43-1
	TRPM4	ENST00000427978.6	TSL:1	c.1459_1494delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC	p.Lys487_Leu498del	conservative_inframe_deletion	Exon 11 of 24	ENSP00000407492.1	Q8TD43-3
	TRPM4	ENST00000595519.5	TSL:1	n.*869_*904delAAAGCCCCAGCCCTAAAAGGGGGAGCTGCGGAGCTC		non_coding_transcript_exon	Exon 9 of 23	ENSP00000469893.1	M0QYK7

Frequencies

GnomAD3 genomes AF: 0.00730 AC: 1111 AN: 152242 Hom.: 5 Cov.: 32

Gnomad AFR AF: 0.00200

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00379

Gnomad ASJ AF: 0.0144

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00971

Gnomad FIN AF: 0.00405

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0120

Gnomad OTH AF: 0.00622

GnomAD2 exomes AF: 0.00784 AC: 1944 AN: 247918 AF XY: 0.00792

Gnomad AFR exome AF: 0.00177

Gnomad AMR exome AF: 0.00602

Gnomad ASJ exome AF: 0.0146

Gnomad EAS exome AF: 0.000109

Gnomad FIN exome AF: 0.00333

Gnomad NFE exome AF: 0.0111

Gnomad OTH exome AF: 0.0113

GnomAD4 exome AF: 0.0117 AC: 17131 AN: 1461656 Hom.: 133 AF XY: 0.0116 AC XY: 8425 AN XY: 727134

African (AFR) AF: 0.00140 AC: 47 AN: 33478

American (AMR) AF: 0.00657 AC: 294 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.0147 AC: 383 AN: 26124

East Asian (EAS) AF: 0.0000756 AC: 3 AN: 39696

South Asian (SAS) AF: 0.00665 AC: 574 AN: 86258

European-Finnish (FIN) AF: 0.00456 AC: 243 AN: 53336

Middle Eastern (MID) AF: 0.00364 AC: 21 AN: 5768

European-Non Finnish (NFE) AF: 0.0134 AC: 14889 AN: 1111902

Other (OTH) AF: 0.0112 AC: 677 AN: 60374

GnomAD4 genome AF: 0.00729 AC: 1110 AN: 152360 Hom.: 5 Cov.: 32 AF XY: 0.00695 AC XY: 518 AN XY: 74508

African (AFR) AF: 0.00200 AC: 83 AN: 41594

American (AMR) AF: 0.00379 AC: 58 AN: 15306

Ashkenazi Jewish (ASJ) AF: 0.0144 AC: 50 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5178

South Asian (SAS) AF: 0.00972 AC: 47 AN: 4834

European-Finnish (FIN) AF: 0.00405 AC: 43 AN: 10626

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0120 AC: 816 AN: 68034

Other (OTH) AF: 0.00616 AC: 13 AN: 2112

Alfa AF: 0.0108 Hom.: 3

Bravo AF: 0.00688

Asia WGS AF: 0.00346 AC: 12 AN: 3478

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	2	not specified (2)
-	1	-	Brugada syndrome (1)
-	-	1	Cardiomyopathy (1)
-	-	1	Cardiovascular phenotype (1)
-	-	1	Progressive familial heart block type IB (1)
-	-	1	TRPM4-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.8
Mutation Taster		=181/19	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs878855029; hg19: chr19-49686028; COSMIC: COSV53262022; COSMIC: COSV53262022;