rs879254451

chr19-11102727-AGTTCTGGAG-A

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PM1 PM4 PP3 PP5_Strong

The NM_000527.5(LDLR):c.257_265del(p.Phe86_Arg88del) variant causes a inframe deletion change involving the alteration of a conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (★★★). Synonymous variant affecting the same amino acid position (i.e. Q85Q) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 31)
• Consequence: LDLR NM_000527.5 inframe_deletion
• Clinical Significance: Uncertain significance reviewed by expert panel P:4 U:1
• Conservation: PhyloP100: 9.88

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

ACMG classification

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 10 uncertain in NM_000527.5
• PM4: Nonframeshift variant in NON repetitive region in NM_000527.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 19-11102727-AGTTCTGGAG-A is Pathogenic according to our data. Variant chr19-11102727-AGTTCTGGAG-A is described in ClinVar as [Uncertain_significance]. Clinvar id is 251097.Status of the report is reviewed_by_expert_panel, 3 stars. We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=1, Likely_pathogenic=3, Pathogenic=1}. Variant chr19-11102727-AGTTCTGGAG-A is described in Lovd as [Likely_pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
LDLR	NM_000527.5	c.257_265del	p.Phe86_Arg88del	inframe_deletion	3/18	ENST00000558518.6

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
LDLR	ENST00000558518.6	c.257_265del	p.Phe86_Arg88del	inframe_deletion	3/18	1	NM_000527.5	P3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Pathogenic:4 Uncertain:1

Revision: reviewed by expert panel

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:1 Uncertain:1

Uncertain significance, reviewed by expert panel	curation	ClinGen Familial Hypercholesterolemia Variant Curation Expert Panel	Aug 29, 2022	The NM_000527.5(LDLR):c.257_265del (p.Phe86_Arg88del) variant is classified as Uncertain significance - insufficient evidence for Familial Hypercholesterolemia by applying evidence code PM2, PM4, BP4 and PP4 as defined by the ClinGen Familial Hypercholesterolemia Expert Panel LDLR-specific variant curation guidelines (https://doi.org/10.1016/j.gim.2021.09.012). The supporting evidence is as follows: PM2 - This variant is absent from gnomAD (gnomAD v2.1.1). PM4 - Variant meets PM2 and is in frame deletion. BP4 - No REVEL, splicing is needed: A - not on limits. B - not on limits C - There are 2 AG sites nearby: 1- Wild type canonical acceptor: CAATCCTGTCTCTTCTGTAGTGT: 7.07 Wild type cryptic acceptor: CAACCGCTGCATTCCTCAGTTCT: -15.64 Variant cryptic acceptor: CAACCGCTGCATTCCTCAGTGCG: -13.6 cryptic sites have negative scores, so they are not used 2- > Wild type canonical acceptor: CAATCCTGTCTCTTCTGTAGTGT: 7.07 Wild type cryptic acceptor: CTGGAGGTGCGATGGCCAAGTGG: -7.59 Variant cryptic acceptor: TCCTCAGTGCGATGGCCAAGTGG: -4.74 cryptic sites have negative scores, so they are not used There is a GT site nearby: Wild type canonical acceptor: GTCGTAAGT: 9.9 Wild type cryptic acceptor: CAGTTCTGG: -3.44 Variant cryptic acceptor: CAGTGCGAT: -14.44 cryptic sites have negative scores, so they are not used The variant does not affect splicing, so BP4 is met.. PP4 - Variant meets PM2 and is identified in one index case from PMID 11462246. -
Likely pathogenic, criteria provided, single submitter	literature only	LDLR-LOVD, British Heart Foundation	Mar 25, 2016	- -

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Nov 21, 2016

The c.257_265delTCTGGAGGT likely pathogenic variant (also described as F65_R67del due to alternate nomenclature) in the LDLR gene has been reported previously in at least one German individual with a diagnosis of FH (Geisel et al., 1998; Nauck et al., 2001). This variant was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project or in the Exome Aggregation Consortium, indicating it is not a common benign variant in these populations. Although the c.257_265delTCTGGAGGT variant causes the in-frame deletion of three amino acids which does not result in protein truncation, a missense variant at residue Tryptophan 87 has been shown to result in binding defective protein (Leitersdorf et al., 1990). However, in the absence of functional mRNA studies, the physiological consequence of this variant cannot be precisely determined.Therefore, this variant is likely pathogenic. In order to definitively determine its clinical significance, additional data is required. -

Cardiovascular phenotype Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Nov 20, 2021

The c.257_265delTCTGGAGGT variant (also known as p.F86_R88del) is located in coding exon 3 of the LDLR gene. This variant results from an in-frame TCTGGAGGT deletion at nucleotide positions 257 to 265. This results in the in-frame deletion of phenylalanine, tryptophan, and arginine at codon 86. This alteration (also known as delF65-R67) has been reported in individuals with familial hypercholesterolemia (FH) (Ambry internal data; Nauck MS et al. Hum. Mutat., 2001 Aug;18:165-6; Villéger L et al. Hum. Mutat., 2002 Aug;20:81-7). Based on internal structural analysis, this variant is anticipated to result in a significant decrease in structural stability (Kurniawan ND et al. Protein Sci., 2000 Jul;9:1282-93). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The amino acid positions range from poorly conserved to highly conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -

Familial hypercholesterolemia Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Invitae

Aug 27, 2023

This variant, c.257_265del, results in the deletion of 3 amino acid(s) of the LDLR protein (p.Phe86_Arg88del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individuals with familial hypercholesterolemia (PMID: 9676383, 11462246; Invitae). This variant is also known as delF65-R67. ClinVar contains an entry for this variant (Variation ID: 251097). This variant disrupts a region of the LDLR protein in which other variant(s) (p.Trp87Gly) have been determined to be pathogenic (PMID: 2318961, 8098448, 12553167, 16542394). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs879254451; hg19: chr19-11213403;