rs879254451

Variant names:

• chr19-11102727-AGTTCTGGAG-A
• rs879254451
• NM_000527.5:c.257_265delTCTGGAGGT

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 5P and 1B. PM4 PM2 PP4 BP4

This summary comes from the ClinGen Evidence Repository: The NM_000527.5(LDLR):c.257_265del (p.Phe86_Arg88del) variant is classified as Uncertain significance - insufficient evidence for Familial Hypercholesterolemia by applying evidence code PM2, PM4, BP4 and PP4 as defined by the ClinGen Familial Hypercholesterolemia Expert Panel LDLR-specific variant curation guidelines (https://doi.org/10.1016/j.gim.2021.09.012).The supporting evidence is as follows:PM2 - This variant is absent from gnomAD (gnomAD v2.1.1).PM4 - Variant meets PM2 and is in frame deletion.BP4 - No REVEL, splicing is needed:A - not on limits.B - not on limitsC - There are 2 AG sites nearby:1- Wild type canonical acceptor: CAATCCTGTCTCTTCTGTAGTGT: 7.07Wild type cryptic acceptor: CAACCGCTGCATTCCTCAGTTCT: -15.64Variant cryptic acceptor: CAACCGCTGCATTCCTCAGTGCG: -13.6cryptic sites have negative scores, so they are not used2- > Wild type canonical acceptor: CAATCCTGTCTCTTCTGTAGTGT: 7.07Wild type cryptic acceptor: CTGGAGGTGCGATGGCCAAGTGG: -7.59Variant cryptic acceptor: TCCTCAGTGCGATGGCCAAGTGG: -4.74 cryptic sites have negative scores, so they are not used There is a GT site nearby:Wild type canonical acceptor: GTCGTAAGT: 9.9Wild type cryptic acceptor: CAGTTCTGG: -3.44Variant cryptic acceptor: CAGTGCGAT: -14.44cryptic sites have negative scores, so they are not usedThe variant does not affect splicing, so BP4 is met..PP4 - Variant meets PM2 and is identified in one index case from PMID 11462246. LINK:https://erepo.genome.network/evrepo/ui/classification/CA10584812/MONDO:0007750/013

• Frequency: Genomes: not found (cov: 31)
• Consequence: LDLR NM_000527.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance reviewed by expert panel P:5 U:1
• Conservation: PhyloP100: 9.88
• Publications: 0 publications found

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

LDLR Gene-Disease associations (from GenCC):

• hypercholesterolemia, familial, 1

  Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), ClinGen
• homozygous familial hypercholesterolemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for LDLR are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM2: For more information check the summary or visit ClinGen Evidence Repository.
• PM4: For more information check the summary or visit ClinGen Evidence Repository.
• PP4: For more information check the summary or visit ClinGen Evidence Repository.
• BP4: For more information check the summary or visit ClinGen Evidence Repository.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000527.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	NM_000527.5	MANE Select	c.257_265delTCTGGAGGT	p.Phe86_Arg88del	disruptive_inframe_deletion	Exon 3 of 18	NP_000518.1	P01130-1
	LDLR	NM_001195798.2		c.257_265delTCTGGAGGT	p.Phe86_Arg88del	disruptive_inframe_deletion	Exon 3 of 18	NP_001182727.1	P01130-5
	LDLR	NM_001195800.2		c.257_265delTCTGGAGGT	p.Phe86_Arg88del	disruptive_inframe_deletion	Exon 3 of 16	NP_001182729.1	P01130-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	ENST00000558518.6	TSL:1 MANE Select	c.257_265delTCTGGAGGT	p.Phe86_Arg88del	disruptive_inframe_deletion	Exon 3 of 18	ENSP00000454071.1	P01130-1
	LDLR	ENST00000252444.10	TSL:1	c.515_523delTCTGGAGGT	p.Phe172_Arg174del	disruptive_inframe_deletion	Exon 3 of 18	ENSP00000252444.6	J3KMZ9
	LDLR	ENST00000558013.5	TSL:1	c.257_265delTCTGGAGGT	p.Phe86_Arg88del	disruptive_inframe_deletion	Exon 3 of 18	ENSP00000453346.1	P01130-5

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
1	1	-	Hypercholesterolemia, familial, 1 (2)
2	-	-	not provided (2)
1	-	-	Cardiovascular phenotype (1)
1	-	-	Familial hypercholesterolemia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs879254451;

hg19: chr19-11213403;