rs879254472

Positions:

• chr19-11105220-CCCCCAAGACGTGCTCCCAGGA-C

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PM1 PM2 PM4 PP5_Very_Strong

The NM_000527.5(LDLR):​c.316_336delCCCAAGACGTGCTCCCAGGAC​(p.Pro106_Asp112del) variant causes a conservative inframe deletion, splice region change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P106P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: LDLR NM_000527.5 conservative_inframe_deletion, splice_region
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 4.65

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PM1: In a domain LDL-receptor class A 2 (size 40) in uniprot entity LDLR_HUMAN there are 46 pathogenic changes around while only 6 benign (88%) in NM_000527.5
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000527.5.
• PP5: Variant 19-11105220-CCCCCAAGACGTGCTCCCAGGA-C is Pathogenic according to our data. Variant chr19-11105220-CCCCCAAGACGTGCTCCCAGGA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 251149.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr19-11105220-CCCCCAAGACGTGCTCCCAGGA-C is described in Lovd as [Likely_pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
LDLR	NM_000527.5	c.316_336delCCCAAGACGTGCTCCCAGGAC	p.Pro106_Asp112del	conservative_inframe_deletion, splice_region_variant	4/18	ENST00000558518.6	NP_000518.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
LDLR	ENST00000558518.6	c.316_336delCCCAAGACGTGCTCCCAGGAC	p.Pro106_Asp112del	conservative_inframe_deletion, splice_region_variant	4/18	1	NM_000527.5	ENSP00000454071.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:2

Likely pathogenic, criteria provided, single submitter	literature only	LDLR-LOVD, British Heart Foundation	Mar 25, 2016	- -
Likely pathogenic, criteria provided, single submitter	clinical testing	Centre de Génétique Moléculaire et Chromosomique, Unité de génétique de l'Obésité et des Dyslipidémies, APHP, GH Hôpitaux Universitaires Pitié-Salpêtrière / Charles-Foix	Dec 16, 2016	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs879254472; hg19: chr19-11215896;