rs879254472

Variant names:

• chr19-11105220-CCCCCAAGACGTGCTCCCAGGA-C
• rs879254472
• NM_000527.5:c.316_336delCCCAAGACGTGCTCCCAGGAC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PM1 PM4 PP5_Very_Strong

The NM_000527.5(LDLR):​c.316_336delCCCAAGACGTGCTCCCAGGAC​(p.Pro106_Asp112del) variant causes a conservative inframe deletion, splice region change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P106P) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: LDLR NM_000527.5 conservative_inframe_deletion, splice_region
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 4.65
• Publications: 0 publications found

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

LDLR Gene-Disease associations (from GenCC):

• hypercholesterolemia, familial, 1

  Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen
• homozygous familial hypercholesterolemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PM1: In a hotspot region, there are 22 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 13 uncertain in NM_000527.5
• PM4: Nonframeshift variant in NON repetitive region in NM_000527.5.
• PP5: Variant 19-11105220-CCCCCAAGACGTGCTCCCAGGA-C is Pathogenic according to our data. Variant chr19-11105220-CCCCCAAGACGTGCTCCCAGGA-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 251149.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000527.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	NM_000527.5	MANE Select	c.316_336delCCCAAGACGTGCTCCCAGGAC	p.Pro106_Asp112del	conservative_inframe_deletion splice_region	Exon 4 of 18	NP_000518.1
	LDLR	NM_001195798.2		c.316_336delCCCAAGACGTGCTCCCAGGAC	p.Pro106_Asp112del	conservative_inframe_deletion splice_region	Exon 4 of 18	NP_001182727.1
	LDLR	NM_001195799.2		c.193_213delCCCAAGACGTGCTCCCAGGAC	p.Pro65_Asp71del	conservative_inframe_deletion splice_region	Exon 3 of 17	NP_001182728.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDLR	ENST00000558518.6	TSL:1 MANE Select	c.316_336delCCCAAGACGTGCTCCCAGGAC	p.Pro106_Asp112del	conservative_inframe_deletion splice_region	Exon 4 of 18	ENSP00000454071.1
	LDLR	ENST00000252444.10	TSL:1	c.574_594delCCCAAGACGTGCTCCCAGGAC	p.Pro192_Asp198del	conservative_inframe_deletion splice_region	Exon 4 of 18	ENSP00000252444.6
	LDLR	ENST00000558013.5	TSL:1	c.316_336delCCCAAGACGTGCTCCCAGGAC	p.Pro106_Asp112del	conservative_inframe_deletion splice_region	Exon 4 of 18	ENSP00000453346.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Hypercholesterolemia, familial, 1 (2)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.7
Mutation Taster		=27/173	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs879254472; hg19: chr19-11215896;