rs879254598
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000527.5(LDLR):c.623_644delAGTGCATCCACTCCAGCTGGCG(p.Glu208AlafsTer50) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000527.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- hypercholesterolemia, familial, 1Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen, Genomics England PanelApp
- homozygous familial hypercholesterolemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000527.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LDLR | NM_000527.5 | MANE Select | c.623_644delAGTGCATCCACTCCAGCTGGCG | p.Glu208AlafsTer50 | frameshift | Exon 4 of 18 | NP_000518.1 | P01130-1 | |
| LDLR | NM_001195798.2 | c.623_644delAGTGCATCCACTCCAGCTGGCG | p.Glu208AlafsTer50 | frameshift | Exon 4 of 18 | NP_001182727.1 | P01130-5 | ||
| LDLR | NM_001195799.2 | c.500_521delAGTGCATCCACTCCAGCTGGCG | p.Glu167AlafsTer50 | frameshift | Exon 3 of 17 | NP_001182728.1 | P01130-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LDLR | ENST00000558518.6 | TSL:1 MANE Select | c.623_644delAGTGCATCCACTCCAGCTGGCG | p.Glu208AlafsTer50 | frameshift | Exon 4 of 18 | ENSP00000454071.1 | P01130-1 | |
| LDLR | ENST00000252444.10 | TSL:1 | c.881_902delAGTGCATCCACTCCAGCTGGCG | p.Glu294AlafsTer50 | frameshift | Exon 4 of 18 | ENSP00000252444.6 | J3KMZ9 | |
| LDLR | ENST00000558013.5 | TSL:1 | c.623_644delAGTGCATCCACTCCAGCTGGCG | p.Glu208AlafsTer50 | frameshift | Exon 4 of 18 | ENSP00000453346.1 | P01130-5 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at