rs879254645

Variant names:

• chr19-11105596-CTGCGGTATGGGCGGGGCCAGGG-C
• rs879254645
• NM_000527.5:c.693_694+20delCGGTATGGGCGGGGCCAGGGTG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000527.5(LDLR):​c.693_694+20delCGGTATGGGCGGGGCCAGGGTG​(p.Ala232LeufsTer27) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. C231C) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: LDLR NM_000527.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 9.88
• Publications: 0 publications found

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

LDLR Gene-Disease associations (from GenCC):

• hypercholesterolemia, familial, 1

  Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen
• homozygous familial hypercholesterolemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 19-11105596-CTGCGGTATGGGCGGGGCCAGGG-C is Pathogenic according to our data. Variant chr19-11105596-CTGCGGTATGGGCGGGGCCAGGG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 251399.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LDLR	NM_000527.5	c.693_694+20delCGGTATGGGCGGGGCCAGGGTG	p.Ala232LeufsTer27	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 4 of 18	ENST00000558518.6	NP_000518.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LDLR	ENST00000558518.6	c.691_694+18delTGCGGTATGGGCGGGGCCAGGG	p.Cys231LeufsTer27	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 4 of 18	1	NM_000527.5	ENSP00000454071.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:2

Mar 25, 2016

LDLR-LOVD, British Heart Foundation

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: literature only

- -

Mar 30, 2017

U4M - Lille University & CHRU Lille, Université de Lille - CHRU de Lille

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs879254645; hg19: chr19-11216272;