rs886037758

Variant names:

• chr1-245688125-CGGGACCTCGCCCCCCAGCTCCG-C
• rs886037758
• NM_018012.4:c.5146_5167delACCTCGCCCCCCAGCTCCGGGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate

The NM_018012.4(KIF26B):​c.5146_5167delACCTCGCCCCCCAGCTCCGGGG​(p.Thr1716ProfsTer13) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: KIF26B NM_018012.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.00
• Publications: 1 publications found

Genes affected

KIF26B (HGNC:25484): (kinesin family member 26B) The protein encoded by this gene is an intracellular motor protein thought to transport organelles along microtubules. The encoded protein is required for kidney development. Elevated levels of this protein have been found in some breast and colorectal cancers. [provided by RefSeq, Mar 2017]

LOC105373265 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PP5: Variant 1-245688125-CGGGACCTCGCCCCCCAGCTCCG-C is Pathogenic according to our data. Variant chr1-245688125-CGGGACCTCGCCCCCCAGCTCCG-C is described in ClinVar as [Pathogenic]. Clinvar id is 217290.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KIF26B	NM_018012.4	c.5146_5167delACCTCGCCCCCCAGCTCCGGGG	p.Thr1716ProfsTer13	frameshift_variant	Exon 12 of 15	ENST00000407071.7	NP_060482.2
LOC105373265	XR_007066988.1	n.657-3696_657-3675delCGGAGCTGGGGGGCGAGGTCCC		intron_variant	Intron 3 of 5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KIF26B	ENST00000407071.7	c.5146_5167delACCTCGCCCCCCAGCTCCGGGG	p.Thr1716ProfsTer13	frameshift_variant	Exon 12 of 15	1	NM_018012.4	ENSP00000385545.2
KIF26B	ENST00000366518.4	c.4003_4024delACCTCGCCCCCCAGCTCCGGGG	p.Thr1335ProfsTer13	frameshift_variant	Exon 9 of 12	5		ENSP00000355475.4

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Oct 19, 2015

Division of Blood Purification, Kakanzawa University’

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.0
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886037758; hg19: chr1-245851427;