rs886038668

Variant names:

• chr10-71695484-AACCTGGTGGAGATGACCCCTCCAG-A
• rs886038668
• NM_022124.6:c.2359_2382delCTGGTGGAGATGACCCCTCCAGAC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The ENST00000224721.12(CDH23):​c.2359_2382delCTGGTGGAGATGACCCCTCCAGAC​(p.Leu787_Asp794del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. L787L) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 34)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CDH23 ENST00000224721.12 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 B:1
• Conservation: PhyloP100: 9.49
• Publications: 0 publications found

Genes affected

CDH23 (HGNC:13733): (cadherin related 23) This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]

CDH23 Gene-Disease associations (from GenCC):

• autosomal recessive nonsyndromic hearing loss 12

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, PanelApp Australia
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Usher syndrome type 1

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• Usher syndrome type 1D

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), PanelApp Australia
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in ENST00000224721.12.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000224721.12. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDH23	NM_022124.6	MANE Select	c.2359_2382delCTGGTGGAGATGACCCCTCCAGAC	p.Leu787_Asp794del	conservative_inframe_deletion	Exon 22 of 70	NP_071407.4
	CDH23	NM_001171930.2		c.2359_2382delCTGGTGGAGATGACCCCTCCAGAC	p.Leu787_Asp794del	conservative_inframe_deletion	Exon 22 of 32	NP_001165401.1
	CDH23	NM_001171931.2		c.2359_2382delCTGGTGGAGATGACCCCTCCAGAC	p.Leu787_Asp794del	conservative_inframe_deletion	Exon 22 of 26	NP_001165402.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CDH23	ENST00000224721.12	TSL:5 MANE Select	c.2359_2382delCTGGTGGAGATGACCCCTCCAGAC	p.Leu787_Asp794del	conservative_inframe_deletion	Exon 22 of 70	ENSP00000224721.9
	CDH23	ENST00000616684.4	TSL:5	c.2359_2382delCTGGTGGAGATGACCCCTCCAGAC	p.Leu787_Asp794del	conservative_inframe_deletion	Exon 22 of 32	ENSP00000482036.2
	CDH23	ENST00000398809.9	TSL:5	c.2359_2382delCTGGTGGAGATGACCCCTCCAGAC	p.Leu787_Asp794del	conservative_inframe_deletion	Exon 22 of 32	ENSP00000381789.5

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 6.84e-7 AC: 1 AN: 1461276 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726962

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33474

American (AMR) AF: 0.00 AC: 0 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26122

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86250

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53382

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111504

Other (OTH) AF: 0.0000166 AC: 1 AN: 60358

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 34

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886038668; hg19: chr10-73455241;