rs886039830

Variant names:

• chr19-11105521-AAGTGGCGAGTGCATCCACTCC-A
• rs886039830
• NM_000527.5:c.618_638delTGGCGAGTGCATCCACTCCAG

Variant summary

Our verdict is Pathogenic. Variant got 15 ACMG points: 15P and 0B. PM1 PM2 PM4 PP3 PP5_Very_Strong

The NM_000527.5(LDLR):​c.618_638delTGGCGAGTGCATCCACTCCAG​(p.Gly207_Ser213del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: LDLR NM_000527.5 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 9.88

Genes affected

LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 15 ACMG points.

• PM1: In a disulfide_bond (size 18) in uniprot entity LDLR_HUMAN there are 41 pathogenic changes around while only 2 benign (95%) in NM_000527.5
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000527.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 19-11105521-AAGTGGCGAGTGCATCCACTCC-A is Pathogenic according to our data. Variant chr19-11105521-AAGTGGCGAGTGCATCCACTCC-A is described in ClinVar as [Pathogenic]. Clinvar id is 265899.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LDLR	NM_000527.5	c.618_638delTGGCGAGTGCATCCACTCCAG	p.Gly207_Ser213del	disruptive_inframe_deletion	Exon 4 of 18	ENST00000558518.6	NP_000518.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LDLR	ENST00000558518.6	c.618_638delTGGCGAGTGCATCCACTCCAG	p.Gly207_Ser213del	disruptive_inframe_deletion	Exon 4 of 18	1	NM_000527.5	ENSP00000454071.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:2

Mar 01, 2016

Cardiovascular Research Group, Instituto Nacional de Saude Doutor Ricardo Jorge

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

0/190 non-FH alleles -

Mar 30, 2017

U4M - Lille University & CHRU Lille, Université de Lille - CHRU de Lille

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs886039830; hg19: chr19-11216197;