rs886041058

Variant names:

• chr19-54188277-TGGGGGCCACAGGTGAACAGG-T
• rs886041058
• NM_024298.5:c.126_145delCCTGTTCACCTGTGGCCCCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_024298.5(MBOAT7):​c.126_145delCCTGTTCACCTGTGGCCCCC​(p.Leu43HisfsTer69) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T42T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MBOAT7 NM_024298.5 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 8.57
• Publications: 1 publications found

Genes affected

MBOAT7 (HGNC:15505): (membrane bound O-acyltransferase domain containing 7) This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]

MBOAT7 Gene-Disease associations (from GenCC):

• intellectual disability, autosomal recessive 57

  Inheritance: AR Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• autosomal recessive non-syndromic intellectual disability

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 19-54188277-TGGGGGCCACAGGTGAACAGG-T is Pathogenic according to our data. Variant chr19-54188277-TGGGGGCCACAGGTGAACAGG-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 268111.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MBOAT7	NM_024298.5	c.126_145delCCTGTTCACCTGTGGCCCCC	p.Leu43HisfsTer69	frameshift_variant	Exon 3 of 8	ENST00000245615.6	NP_077274.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MBOAT7	ENST00000245615.6	c.126_145delCCTGTTCACCTGTGGCCCCC	p.Leu43HisfsTer69	frameshift_variant	Exon 3 of 8	1	NM_024298.5	ENSP00000245615.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual disability, autosomal recessive 57 Pathogenic:2

May 27, 2020

Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

The homozygous p.Leu43HisfsTer69 variant in MBOAT7 was identified by our study in 2 siblings with autosomal recessive intellectual disability (PMID: 27616480), and segregated with disease in 3 affected relatives from a consanguineous family (PMID: 27616480). This variant was absent from large population studies and has also been reported pathogenic by OMIM in ClinVar (Variation ID: 268111). This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 43 and leads to a premature termination codon 69 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. While there is some evidence to suggest that loss of function of the MBOAT7 gene is a disease mechanism in autosomal recessive intellectual disability, this association is not yet strongly established based on the criteria laid out in Tayoun, 2018 (PMID: 30192042). In summary, although additional studies are required to fully establish its clinical significance, this variant is likely pathogenic. ACMG/AMP Criteria applied: PVS1_Strong, PM2, PM3_Supporting, PP1 (Richards 2015). -

Jan 26, 2022

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.6
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886041058; hg19: chr19-54692131;