rs886041058
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_024298.5(MBOAT7):c.126_145delCCTGTTCACCTGTGGCCCCC(p.Leu43HisfsTer69) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T42T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_024298.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- complex neurodevelopmental disorderInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- intellectual disability, autosomal recessive 57Inheritance: AR Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- autosomal recessive non-syndromic intellectual disabilityInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_024298.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MBOAT7 | MANE Select | c.126_145delCCTGTTCACCTGTGGCCCCC | p.Leu43HisfsTer69 | frameshift | Exon 3 of 8 | NP_077274.3 | |||
| MBOAT7 | c.34_53delCCTGTTCACCTGTGGCCCCC | p.Pro12ThrfsTer27 | frameshift | Exon 2 of 6 | NP_001139528.1 | Q96N66-2 | |||
| MBOAT7 | c.34_53delCCTGTTCACCTGTGGCCCCC | p.Pro12ThrfsTer27 | frameshift | Exon 3 of 7 | NP_001139555.1 | Q96N66-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MBOAT7 | TSL:1 MANE Select | c.126_145delCCTGTTCACCTGTGGCCCCC | p.Leu43HisfsTer69 | frameshift | Exon 3 of 8 | ENSP00000245615.1 | Q96N66-1 | ||
| MBOAT7 | TSL:1 | c.34_53delCCTGTTCACCTGTGGCCCCC | p.Pro12ThrfsTer27 | frameshift | Exon 3 of 7 | ENSP00000410503.2 | Q96N66-2 | ||
| MBOAT7 | TSL:1 | c.126_145delCCTGTTCACCTGTGGCCCCC | p.Leu43HisfsTer69 | frameshift | Exon 3 of 7 | ENSP00000375634.1 | Q96N66-3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at