rs886041392
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000352.6(ABCC8):c.3130_3149delACCCCTGCAGCCAGGAACTG(p.Thr1044LeufsTer63) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000558 in 1,614,030 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T1044T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000352.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- hyperinsulinemic hypoglycemia, familial, 1Inheritance: AD, AR, SD Classification: DEFINITIVE, STRONG Submitted by: Illumina, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- diabetes mellitus, permanent neonatal 3Inheritance: AR, AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- familial hyperinsulinismInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women's Health
- diabetes mellitusInheritance: SD Classification: DEFINITIVE Submitted by: Ambry Genetics
- monogenic diabetesInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- diabetes mellitus, noninsulin-dependentInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- hypoglycemia, leucine-inducedInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- transient neonatal diabetes mellitusInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
- permanent neonatal diabetes mellitusInheritance: AR, AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
- diabetes mellitus, transient neonatal, 2Inheritance: Unknown, AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- pulmonary arterial hypertensionInheritance: AD Classification: MODERATE Submitted by: ClinGen
- autosomal dominant hyperinsulinism due to SUR1 deficiencyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- DEND syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- diazoxide-resistant focal hyperinsulinism due to SUR1 deficiencyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- maturity-onset diabetes of the youngInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive hyperinsulinism due to SUR1 deficiencyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- type 2 diabetes mellitusInheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000352.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ABCC8 | MANE Select | c.3130_3149delACCCCTGCAGCCAGGAACTG | p.Thr1044LeufsTer63 | frameshift | Exon 25 of 39 | NP_000343.2 | Q09428-1 | ||
| ABCC8 | c.3196_3215delACCCCTGCAGCCAGGAACTG | p.Thr1066LeufsTer63 | frameshift | Exon 25 of 39 | NP_001338224.1 | A0A2R8Y4V0 | |||
| ABCC8 | c.3133_3152delACCCCTGCAGCCAGGAACTG | p.Thr1045LeufsTer63 | frameshift | Exon 25 of 39 | NP_001274103.1 | Q09428-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ABCC8 | TSL:1 MANE Select | c.3130_3149delACCCCTGCAGCCAGGAACTG | p.Thr1044LeufsTer63 | frameshift | Exon 25 of 39 | ENSP00000374467.4 | Q09428-1 | ||
| ABCC8 | c.3196_3215delACCCCTGCAGCCAGGAACTG | p.Thr1066LeufsTer63 | frameshift | Exon 25 of 39 | ENSP00000494321.1 | A0A2R8Y4V0 | |||
| ABCC8 | TSL:5 | c.3133_3152delACCCCTGCAGCCAGGAACTG | p.Thr1045LeufsTer63 | frameshift | Exon 25 of 39 | ENSP00000303960.4 | Q09428-2 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152262Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00000797 AC: 2AN: 250882 AF XY: 0.00000737 show subpopulations
GnomAD4 exome AF: 0.00000547 AC: 8AN: 1461768Hom.: 0 AF XY: 0.00000688 AC XY: 5AN XY: 727192 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152262Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74398 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.