rs886041392

Variant names:

• chr11-17406900-GCAGTTCCTGGCTGCAGGGGT-G
• rs886041392
• NM_000352.6:c.3130_3149delACCCCTGCAGCCAGGAACTG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000352.6(ABCC8):​c.3130_3149delACCCCTGCAGCCAGGAACTG​(p.Thr1044LeufsTer63) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000558 in 1,614,030 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T1044T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000055 (0 hom.)
• Consequence: ABCC8 NM_000352.6 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:7
• Conservation: PhyloP100: 7.50
• Publications: 3 publications found

Genes affected

ABCC8 (HGNC:59): (ATP binding cassette subfamily C member 8) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations in the ABCC8 gene and deficiencies in the encoded protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2020]

ABCC8 Gene-Disease associations (from GenCC):

• hyperinsulinemic hypoglycemia, familial, 1

  Inheritance: AD, AR, SD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Illumina, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• diabetes mellitus, permanent neonatal 3

  Inheritance: AR, SD, AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• familial hyperinsulinism

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• diabetes mellitus

  Inheritance: SD Classification: DEFINITIVE Submitted by: Ambry Genetics
• monogenic diabetes

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• diabetes mellitus, noninsulin-dependent

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• hypoglycemia, leucine-induced

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• transient neonatal diabetes mellitus

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• permanent neonatal diabetes mellitus

  Inheritance: AR, AD Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• diabetes mellitus, transient neonatal, 2

  Inheritance: Unknown, AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• pulmonary arterial hypertension

  Inheritance: AD Classification: MODERATE Submitted by: ClinGen
• autosomal dominant hyperinsulinism due to SUR1 deficiency

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• DEND syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• diazoxide-resistant focal hyperinsulinism due to SUR1 deficiency

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• maturity-onset diabetes of the young

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive hyperinsulinism due to SUR1 deficiency

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• type 2 diabetes mellitus

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 11-17406900-GCAGTTCCTGGCTGCAGGGGT-G is Pathogenic according to our data. Variant chr11-17406900-GCAGTTCCTGGCTGCAGGGGT-G is described in ClinVar as [Pathogenic]. Clinvar id is 280115.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ABCC8	NM_000352.6	c.3130_3149delACCCCTGCAGCCAGGAACTG	p.Thr1044LeufsTer63	frameshift_variant	Exon 25 of 39	ENST00000389817.8	NP_000343.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ABCC8	ENST00000389817.8	c.3130_3149delACCCCTGCAGCCAGGAACTG	p.Thr1044LeufsTer63	frameshift_variant	Exon 25 of 39	1	NM_000352.6	ENSP00000374467.4

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152262 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000797 AC: 2 AN: 250882 AF XY: 0.00000737

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000176

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000547 AC: 8 AN: 1461768 Hom.: 0 AF XY: 0.00000688 AC XY: 5 AN XY: 727192

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53298

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000719 AC: 8 AN: 1112010

Other (OTH) AF: 0.00 AC: 0 AN: 60396

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152262 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74398

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 41468

American (AMR) AF: 0.00 AC: 0 AN: 15286

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5200

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10630

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68052

Other (OTH) AF: 0.00 AC: 0 AN: 2092

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:7

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hyperinsulinemic hypoglycemia, familial, 1 Pathogenic:4

Aug 16, 2023

Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

The p.Thr1044Leufs variant in ABCC8 has been previously reported in 2 individuals with hyperinsulinemic hypoglycemia (PMID: 11395395, 20685672), and has been identified in 0.002% (2/113358) of European (non-Finnish) chromosomes by the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitute.org; dbSNP ID: rs886041392). Although this variant has been seen in the general population in a heterozygous state, its frequency is low enough to be consistent with a recessive carrier frequency. This variant has also been reported in ClinVar (Variation ID#: 280115) and has been interpreted as likely pathogenic/pathogenic by Invitae, Rady Children's Institute for Genomic Medicine (Rady Children's Hospital San Diego), GeneDx, and Counsyl. Of the 2 affected individuals, 1 was a compound heterozygote that carried a reported pathogenic variant in trans, which increases the likelihood that the p.Thr1044Leufs variant is pathogenic (PMID: 11395395). This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 1044 and leads to a premature termination codon 63 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Loss of function of the ABCC8 gene is an established disease mechanism in autosomal recessive hyperinsulinemic hypoglycemia. In summary, this variant meets criteria to be classified as pathogenic for autosomal recessive hyperinsulinemic hypoglycemia. ACMG/AMP Criteria applied: PVS1, PM2_supporting, PM3 (Richards 2015). -

Mar 01, 2018

Counsyl

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

May 01, 2018

Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant has been previously reported in individuals with congenital hyperinsulism or familial hyperinsulinemic hypoglycemia-1 (HHF1) (MIM: 256450). It has been previously classified as pathogenic for congenital hyperinsulinism in ClinVar (rs886041392, https://www.ncbi.nlm.nih.gov/clinvar/variation/280115/) and HGMD (CD016051). This variant is present in gnomAD at 0.00081% (2/245734) and thus is presumed to be rare. This variant is predicted to create a frameshift in the protein coding sequence, leading to a truncated protein with reduced protein function. Based on the combined evidence, the c.3130_3149del20 p.Thr1044LeufsTer63 variant is classified as pathogenic. -

Aug 18, 2021

Genetics and Molecular Pathology, SA Pathology

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:2

May 04, 2018

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3130_3149del20 pathogenic variant in the ABCC8 gene has been reported previously in the heterozygous state, as well as the compound heterozygous state, in association with congenital hyperinsulinism (Fournet et al., 2001; Bellanne-Chantelot et al., 2010). The c.3130_3149del20 variant causes a frameshift starting with codon Threonine 1044, changes this amino acid to a Leucine residue, and creates a premature Stop codon at position 63 of the new reading frame, denoted p.Thr1044LeufsX63. This variant is predicted to cause loss of normal protein function either through protein truncation or nonsense-mediated mRNA decay. The c.3130_3149del20 variant was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. We interpret c.3130_3149del20 as a pathogenic variant. -

Aug 14, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Thr1044Leufs*63) in the ABCC8 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ABCC8 are known to be pathogenic (PMID: 20685672, 23345197). This variant is present in population databases (no rsID available, gnomAD 0.002%). This premature translational stop signal has been observed in individual(s) with autosomal recessive diffuse or paternally inherited focal hyperinsulinism (PMID: 11395395). This variant has been reported in individual(s) with autosomal dominant familial hyperinsulinism (PMID: 24401662, 32928245); however, the role of the variant in this condition is currently unclear. This variant is also known as c.3133_3152del. ClinVar contains an entry for this variant (Variation ID: 280115). For these reasons, this variant has been classified as Pathogenic. -

Type 2 diabetes mellitus Pathogenic:1

Mar 11, 2024

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886041392; hg19: chr11-17428447;