rs967037646
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong
The NM_000548.5(TSC2):c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA(p.Ile1754fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,460,480 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. I1754I) has been classified as Likely benign.
Frequency
Consequence
NM_000548.5 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant polycystic kidney diseaseInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- polycystic kidney disease 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- autosomal recessive polycystic kidney diseaseInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- Caroli diseaseInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | MANE Select | c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA | p.Ile1754fs | frameshift splice_acceptor splice_region intron | Exon 42 of 42 | NP_000539.2 | P49815-1 | ||
| TSC2 | c.5257-9_5276delTGCCTTCAGATCTGCGAGGAAGCCGCCTA | p.Ile1753fs | frameshift splice_acceptor splice_region intron | Exon 42 of 42 | NP_001393592.1 | A0A2R8Y6C9 | |||
| TSC2 | c.5191-9_5210delTGCCTTCAGATCTGCGAGGAAGCCGCCTA | p.Ile1731fs | frameshift splice_acceptor splice_region intron | Exon 41 of 41 | NP_001107854.1 | P49815-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC2 | TSL:5 MANE Select | c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA | p.Ile1754fs | frameshift splice_acceptor splice_region intron | Exon 42 of 42 | ENSP00000219476.3 | P49815-1 | ||
| TSC2 | TSL:1 | c.5191-9_5210delTGCCTTCAGATCTGCGAGGAAGCCGCCTA | p.Ile1731fs | frameshift splice_acceptor splice_region intron | Exon 41 of 41 | ENSP00000344383.4 | P49815-4 | ||
| TSC2 | TSL:1 | c.5059-9_5078delTGCCTTCAGATCTGCGAGGAAGCCGCCTA | p.Ile1687fs | frameshift splice_acceptor splice_region intron | Exon 40 of 40 | ENSP00000384468.2 | P49815-5 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000205 AC: 3AN: 1460480Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 726536 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.