rs967037646

Variant names:

• chr16-2088436-CTGCCTTCAGATCTGCGAGGAAGCCGCCTA-C
• rs967037646
• NM_000548.5:c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_000548.5(TSC2):​c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA​(p.Ile1754fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,460,480 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. I1754I) has been classified as Benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: TSC2 NM_000548.5 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 8.59

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 14 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1754fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 42 of 42	ENST00000219476.9	NP_000539.2
PKD1	NM_001009944.3	c.*1262_*1290delTAGGCGGCTTCCTCGCAGATCTGAAGGCA		downstream_gene_variant		ENST00000262304.9	NP_001009944.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1754fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 42 of 42	5	NM_000548.5	ENSP00000219476.3
PKD1	ENST00000262304.9	c.*1262_*1290delTAGGCGGCTTCCTCGCAGATCTGAAGGCA		downstream_gene_variant		1	NM_001009944.3	ENSP00000262304.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1460480 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 726536

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000270

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000756

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Tuberous sclerosis 2 Uncertain:1

Jul 26, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Studies have shown that this variant results in skipping of the last exon (exon 42) and introduces a new termination codon (Invitae). However the mRNA is not expected to undergo nonsense-mediated decay. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant results in the deletion of an acceptor splice site in intron 41 and the first 20 nucleotides of exon 42 (c.5260-9_5279del) of the TSC2 gene. RNA analysis indicates that this variant induces altered splicing and likely disrupts the C-terminus of the protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. ClinVar contains an entry for this variant (Variation ID: 406091). -

not provided Uncertain:1

Nov 12, 2018

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed in large population cohorts (Lek et al., 2016; McVean et al., 2012; Exome Variant Server) -

Hereditary cancer-predisposing syndrome Uncertain:1

Aug 14, 2023

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.5260-9_5279del29 variant results from a deletion of 29 nucleotides between positions 5260-9 and 5279 and involves the canonical splice acceptor site before coding exon 41 of the TSC2 gene. The canonical splice acceptor site is well conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site and will result in the creation or strengthening of a novel splice acceptor site. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing. However, this alteration occurs at the 3' terminus of the TSC2 gene and is not expected to trigger nonsense-mediated mRNA decay. The exact functional effect of this alteration is unknown; Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs967037646; hg19: chr16-2138437;