rs967037646

Variant names:

• chr16-2088436-CTGCCTTCAGATCTGCGAGGAAGCCGCCTA-C
• rs967037646
• NM_000548.5:c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_000548.5(TSC2):​c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA​(p.Ile1754fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,460,480 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. I1754I) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: TSC2 NM_000548.5 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 8.59
• Publications: 0 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

PKD1 Gene-Disease associations (from GenCC):

• autosomal dominant polycystic kidney disease

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• polycystic kidney disease 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• autosomal recessive polycystic kidney disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Caroli disease

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 13 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	NM_000548.5	MANE Select	c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1754fs	frameshift splice_acceptor splice_region intron	Exon 42 of 42	NP_000539.2	P49815-1
	TSC2	NM_001406663.1		c.5257-9_5276delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1753fs	frameshift splice_acceptor splice_region intron	Exon 42 of 42	NP_001393592.1	A0A2R8Y6C9
	TSC2	NM_001114382.3		c.5191-9_5210delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1731fs	frameshift splice_acceptor splice_region intron	Exon 41 of 41	NP_001107854.1	P49815-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	ENST00000219476.9	TSL:5 MANE Select	c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1754fs	frameshift splice_acceptor splice_region intron	Exon 42 of 42	ENSP00000219476.3	P49815-1
	TSC2	ENST00000350773.9	TSL:1	c.5191-9_5210delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1731fs	frameshift splice_acceptor splice_region intron	Exon 41 of 41	ENSP00000344383.4	P49815-4
	TSC2	ENST00000401874.7	TSL:1	c.5059-9_5078delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1687fs	frameshift splice_acceptor splice_region intron	Exon 40 of 40	ENSP00000384468.2	P49815-5

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1460480 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 726536

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52050

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000270 AC: 3 AN: 1111992

Other (OTH) AF: 0.00 AC: 0 AN: 60378

GnomAD4 genome Cov.: 33

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	not provided (1)
-	1	-	Tuberous sclerosis 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs967037646; hg19: chr16-2138437;