rs967037646

Positions:

• chr16-2088436-CTGCCTTCAGATCTGCGAGGAAGCCGCCTA-C

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The NM_000548.5(TSC2):​c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA​(p.Ile1754fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,460,480 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. I1754I) has been classified as Benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: TSC2 NM_000548.5 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 8.59

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC2 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 14 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TSC2	NM_000548.5	c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1754fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	42/42	ENST00000219476.9	NP_000539.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.5260-9_5279delTGCCTTCAGATCTGCGAGGAAGCCGCCTA	p.Ile1754fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	42/42	5	NM_000548.5	ENSP00000219476.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1460480 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 726536

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000270

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

Bravo AF: 0.00000756

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Tuberous sclerosis 2 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jul 26, 2023

This variant results in the deletion of an acceptor splice site in intron 41 and the first 20 nucleotides of exon 42 (c.5260-9_5279del) of the TSC2 gene. RNA analysis indicates that this variant induces altered splicing and likely disrupts the C-terminus of the protein. This variant is not present in population databases (gnomAD no frequency). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Studies have shown that this variant results in skipping of the last exon (exon 42) and introduces a new termination codon (Invitae). However the mRNA is not expected to undergo nonsense-mediated decay. ClinVar contains an entry for this variant (Variation ID: 406091). This variant has not been reported in the literature in individuals affected with TSC2-related conditions. -

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Nov 12, 2018

Not observed in large population cohorts (Lek et al., 2016; McVean et al., 2012; Exome Variant Server) -

Hereditary cancer-predisposing syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

Aug 14, 2023

The c.5260-9_5279del29 variant results from a deletion of 29 nucleotides between positions 5260-9 and 5279 and involves the canonical splice acceptor site before coding exon 41 of the TSC2 gene. The canonical splice acceptor site is well conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site and will result in the creation or strengthening of a novel splice acceptor site. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing. However, this alteration occurs at the 3' terminus of the TSC2 gene and is not expected to trigger nonsense-mediated mRNA decay. The exact functional effect of this alteration is unknown; Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs967037646; hg19: chr16-2138437;