rs973803642

Variant names:

• chr3-130894512-GCTCCCGAGATAGTGGCTGGGCGGGGAA-G
• rs973803642
• ENST00000428331.6:c.-253_-227delCGAGATAGTGGCTGGGCGGGGAACTCC

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BS1 BS2

The ENST00000428331.6(ATP2C1):​c.-253_-227delCGAGATAGTGGCTGGGCGGGGAACTCC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000462 in 1,388,952 control chromosomes in the GnomAD database, including 9 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.00033 (1 hom., cov: 31)
  • Exomes 𝑓: 0.00048 (8 hom.)
• Consequence: ATP2C1 ENST00000428331.6 5_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.40
• Publications: 0 publications found

Genes affected

ATP2C1 (HGNC:13211): (ATPase secretory pathway Ca2+ transporting 1) The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium ions. Defects in this gene cause Hailey-Hailey disease, an autosomal dominant disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]

ATP2C1 Gene-Disease associations (from GenCC):

• Hailey-Hailey disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 3-130894512-GCTCCCGAGATAGTGGCTGGGCGGGGAA-G is Benign according to our data. Variant chr3-130894512-GCTCCCGAGATAGTGGCTGGGCGGGGAA-G is described in ClinVar as Benign. ClinVar VariationId is 2654148.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.000328 (50/152210) while in subpopulation SAS AF = 0.00934 (45/4818). AF 95% confidence interval is 0.00717. There are 1 homozygotes in GnomAd4. There are 39 alleles in the male GnomAd4 subpopulation. Median coverage is 31. This position passed quality control check.
• BS2: High AC in GnomAd4 at 50 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000428331.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATP2C1	NM_001378687.1	MANE Select	c.-180-73_-180-47delCGAGATAGTGGCTGGGCGGGGAACTCC		intron	N/A	NP_001365616.1	P98194-1
	ATP2C1	NM_001378511.1		c.109-35899_109-35873delCGAGATAGTGGCTGGGCGGGGAACTCC		intron	N/A	NP_001365440.1
	ATP2C1	NM_001199180.2		c.109-35899_109-35873delCGAGATAGTGGCTGGGCGGGGAACTCC		intron	N/A	NP_001186109.1	P98194-7

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATP2C1	ENST00000428331.6	TSL:1	c.-253_-227delCGAGATAGTGGCTGGGCGGGGAACTCC		5_prime_UTR	Exon 1 of 27	ENSP00000395809.2	P98194-1
	ATP2C1	ENST00000328560.12	TSL:1	c.-253_-227delCGAGATAGTGGCTGGGCGGGGAACTCC		5_prime_UTR	Exon 1 of 27	ENSP00000329664.8	P98194-2
	ATP2C1	ENST00000510168.6	TSL:5 MANE Select	c.-180-73_-180-47delCGAGATAGTGGCTGGGCGGGGAACTCC		intron	N/A	ENSP00000427461.1	P98194-1

Frequencies

GnomAD3 genomes AF: 0.000335 AC: 51 AN: 152092 Hom.: 1 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000654

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00954

Gnomad FIN AF: 0.0000943

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000479 AC: 592 AN: 1236742 Hom.: 8 AF XY: 0.000745 AC XY: 445 AN XY: 597494

African (AFR) AF: 0.00 AC: 0 AN: 27124

American (AMR) AF: 0.0000555 AC: 1 AN: 18022

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 17624

East Asian (EAS) AF: 0.00 AC: 0 AN: 31462

South Asian (SAS) AF: 0.00933 AC: 550 AN: 58962

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 25496

Middle Eastern (MID) AF: 0.000886 AC: 3 AN: 3386

European-Non Finnish (NFE) AF: 0.0000229 AC: 23 AN: 1003996

Other (OTH) AF: 0.000296 AC: 15 AN: 50670

GnomAD4 genome AF: 0.000328 AC: 50 AN: 152210 Hom.: 1 Cov.: 31 AF XY: 0.000524 AC XY: 39 AN XY: 74430

African (AFR) AF: 0.00 AC: 0 AN: 41546

American (AMR) AF: 0.0000653 AC: 1 AN: 15304

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5164

South Asian (SAS) AF: 0.00934 AC: 45 AN: 4818

European-Finnish (FIN) AF: 0.0000943 AC: 1 AN: 10608

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 67982

Other (OTH) AF: 0.00 AC: 0 AN: 2112

Alfa AF: 0.000253 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=247/53	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs973803642; hg19: chr3-130613356;