CCND2

cyclin D2, the group of Cyclins

Basic information

Region (hg38): 12:4269771-4305353

Links

ENSG00000118971 ∙ NCBI:894 ∙ OMIM:123833 ∙ HGNC:1583 ∙ Uniprot:P30279 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 1 (Definitive), mode of inheritance: AD
• megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (Strong), mode of inheritance: AD
• megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (Moderate), mode of inheritance: AD
• megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (Strong), mode of inheritance: AD
• megalencephaly-polymicrogyria-postaxial polydactyly-hydrocephalus syndrome (Supportive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Craniofacial; Musculoskeletal; Neurologic	24705253

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CCND2 gene.

• Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (3 variants)
• Inborn genetic diseases (3 variants)
• not provided (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CCND2 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			2	19	1	22
missense	3	3	33	3		42
nonsense	3	2	2			7
start loss						0
frameshift						0
inframe indel			1			1
splice donor/acceptor (+/-2bp)			1			1
splice region				3	1	4
non coding			1	24	12	37
Total	6	5	40	46	13

Highest pathogenic variant AF is 0.00000657

Variants in CCND2

This is a list of pathogenic ClinVar variants found in the CCND2 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
12-4273433-A-G			Benign (Jun 16, 2018)
12-4273870-C-T			Benign (Jun 14, 2018)
12-4273992-T-C		Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3	Benign (Jul 14, 2021)
12-4274005-G-T		not specified	Benign (Jun 05, 2017)
12-4274049-G-A			Likely benign (Dec 05, 2022)
12-4274065-G-T			Uncertain significance (Oct 03, 2023)
12-4274073-C-T		CCND2-related disorder	Likely benign (Jan 11, 2024)
12-4274128-C-A		Inborn genetic diseases	Uncertain significance (Nov 08, 2022)
12-4274134-A-G			Uncertain significance (Aug 04, 2023)
12-4274140-G-C			Uncertain significance (Jun 24, 2022)
12-4274153-T-G		Inborn genetic diseases	Uncertain significance (Jan 09, 2024)
12-4274154-T-G		CCND2-related disorder	Benign/Likely benign (Nov 01, 2023)
12-4274162-G-A			Uncertain significance (Jul 01, 2024)
12-4274242-C-CG			Benign (Jan 19, 2024)
12-4274252-C-A			Likely benign (Nov 03, 2022)
12-4274504-A-C			Likely benign (Jun 26, 2018)
12-4275795-ATACCAAAGCACTGATGGGCTATTCTGATTCACTCCAGTTTCCTCATCTTTGTTCTTTATTCTTATCACGCATTCTGGTCCCCTCCCCCTCCCACAAAAAAAAATTAATTTTTTTTGTTTCGATAGATTACGCTTTTTTATTCTTTTTCTCTTTTGCTGATGCTATGCTCTCCACCCCCGCCCCCCAACCCTTTCCCACTCCCATTATAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCCATGAAT-A		Inborn genetic diseases	Uncertain significance (May 31, 2024)
12-4275901-A-T			Likely benign (Jul 06, 2018)
12-4275974-G-C			Likely benign (Aug 18, 2019)
12-4275986-T-C			Likely benign (Sep 19, 2023)
12-4275998-A-C			Likely benign (Dec 31, 2019)
12-4276004-G-A		Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3	Uncertain significance (Sep 01, 2022)
12-4276031-A-G			Likely benign (Jan 15, 2024)
12-4276040-C-T			Likely benign (Dec 02, 2021)
12-4276043-T-A			Likely benign (Apr 04, 2021)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
CCND2	protein_coding	protein_coding	ENST00000261254	5	31579

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.987	0.0134	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	2.13	91	169	0.538	0.00000888	1875
Missense in Polyphen		19	60.381	0.31467		716
Synonymous	0.780	67	75.6	0.886	0.00000436	582
Loss of Function	3.35	0	13.0	0.00	5.61e-7	148

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Regulatory component of the cyclin D2-CDK4 (DC) complex that phosphorylates and inhibits members of the retinoblastoma (RB) protein family including RB1 and regulates the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complex and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. Also substrate for SMAD3, phosphorylating SMAD3 in a cell-cycle-dependent manner and repressing its transcriptional activity. Component of the ternary complex, cyclin D2/CDK4/CDKN1B, required for nuclear translocation and activity of the cyclin D-CDK4 complex (By similarity). {ECO:0000250}.
• Disease: DISEASE: Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (MPPH3) [MIM:615938]: A syndrome characterized by megalencephaly, ventriculomegaly that may lead to hydrocephalus, and polymicrogyria; polydactyly may also be seen. There is considerable phenotypic similarity between this disorder and the megalencephaly-capillary malformation syndrome. {ECO:0000269|PubMed:24705253}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: PI3K-Akt signaling pathway - Homo sapiens (human);Focal adhesion - Homo sapiens (human);Cell cycle - Homo sapiens (human);Jak-STAT signaling pathway - Homo sapiens (human);p53 signaling pathway - Homo sapiens (human);FoxO signaling pathway - Homo sapiens (human);HTLV-I infection - Homo sapiens (human);Hippo signaling pathway - Homo sapiens (human);Prolactin signaling pathway - Homo sapiens (human);MicroRNAs in cancer - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Viral carcinogenesis - Homo sapiens (human);Transcriptional misregulation in cancer - Homo sapiens (human);Measles - Homo sapiens (human);Wnt signaling pathway - Homo sapiens (human);Cellular senescence - Homo sapiens (human);Human papillomavirus infection - Homo sapiens (human);Hedgehog signaling pathway - Homo sapiens (human);Cell Cycle;miRNA Regulation of DNA Damage Response;SRF and miRs in Smooth Muscle Differentiation and Proliferation;Signaling Pathways in Glioblastoma;Focal Adhesion;Ovarian Infertility Genes;Wnt Signaling Pathway and Pluripotency;PI3K-Akt Signaling Pathway;Hedgehog Signaling Pathway;Wnt Signaling Pathway;G1 to S cell cycle control;IL-2 Signaling Pathway;DNA Damage Response;DNA Damage Response (only ATM dependent);Gene expression (Transcription);il-2 receptor beta chain in t cell activation;cyclins and cell cycle regulation;multi-step regulation of transcription by pitx2;Generic Transcription Pathway;RNA Polymerase II Transcription;Cyclin D associated events in G1;G1 Phase;Mitotic G1-G1/S phases;Regulation of RUNX1 Expression and Activity;Cell Cycle;Cell Cycle, Mitotic;Regulation of nuclear beta catenin signaling and target gene transcription;Transcriptional regulation by RUNX1;IL2 signaling events mediated by STAT5;Validated targets of C-MYC transcriptional activation;Regulation of retinoblastoma protein (Consensus)

Recessive Scores

• pRec: 0.750

Intolerance Scores

• loftool: 0.107
• rvis_EVS: -0.19
• rvis_percentile_EVS: 39.68

Haploinsufficiency Scores

• pHI: 0.932
• hipred: Y
• hipred_score: 0.786
• ghis: 0.595

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: H
• gene_indispensability_pred: E
• gene_indispensability_score: 0.822

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Ccnd2
• Phenotype: hematopoietic system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); liver/biliary system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); immune system phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype; endocrine/exocrine gland phenotype; homeostasis/metabolism phenotype

Gene ontology

• Biological process: regulation of cyclin-dependent protein serine/threonine kinase activity;mitotic cell cycle;positive regulation of protein phosphorylation;protein phosphorylation;regulation of mitotic nuclear division;positive regulation of cell population proliferation;negative regulation of apoptotic process;positive regulation of cyclin-dependent protein serine/threonine kinase activity;positive regulation of cell cycle;cell division;positive regulation of G1/S transition of mitotic cell cycle
• Cellular component: cyclin-dependent protein kinase holoenzyme complex;chromatin;nucleus;nucleoplasm;nucleolus;cytoplasm;cytosol;nuclear membrane
• Molecular function: protein kinase activity;protein binding;cyclin-dependent protein serine/threonine kinase regulator activity;protein kinase binding