12-4275795-ATACCAAAGCACTGATGGGCTATTCTGATTCACTCCAGTTTCCTCATCTTTGTTCTTTATTCTTATCACGCATTCTGGTCCCCTCCCCCTCCCACAAAAAAAAATTAATTTTTTTTGTTTCGATAGATTACGCTTTTTTATTCTTTTTCTCTTTTGCTGATGCTATGCTCTCCACCCCCGCCCCCCAACCCTTTCCCACTCCCATTATAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCCATGAAT-A

Variant names:

• chr12-4275795-ATACCAAAGCACTGATGGGCTATTCTGATTCACTCCAGTTTCCTCATCTTTGTTCTTTATTCTTATCACGCATTCTGGTCCCCTCCCCCTCCCACAAAAAAAAATTAATTTTTTTTGTTTCGATAGATTACGCTTTTTTATTCTTTTTCTCTTTTGCTGATGCTATGCTCTCCACCCCCGCCCCCCAACCCTTTCCCACTCCCATTATAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCCATGAAT-A
• NM_001759.4:c.196-205_250del

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Strong PM2

The ENST00000261254.8(CCND2):​c.196-209_246del​(p.Val66_Tyr83del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 29)
• Consequence: CCND2 ENST00000261254.8 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.06

Genes affected

CCND2 (HGNC:1583): (cyclin D2) The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK4 or CDK6 and functions as a regulatory subunit of the complex, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. Knockout studies of the homologous gene in mouse suggest the essential roles of this gene in ovarian granulosa and germ cell proliferation. High level expression of this gene was observed in ovarian and testicular tumors. Mutations in this gene are associated with megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (MPPH3). [provided by RefSeq, Sep 2014]

ENSG00000285901 (HGNC:):

CCND2-AS1 (HGNC:49398): (CCND2 antisense RNA 1)

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.24827586 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CCND2	NM_001759.4	c.196-205_250del	p.Val66fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 2 of 5	ENST00000261254.8	NP_001750.1
CCND2-AS1	NR_125790.1	n.126+4_126+263del		splice_region_variant, intron_variant	Intron 1 of 1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CCND2	ENST00000261254.8	c.196-209_246del	p.Val66_Tyr83del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 2 of 5	1	NM_001759.4	ENSP00000261254.3
ENSG00000285901	ENST00000674624.1	n.196-209_246del		splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	Exon 2 of 10			ENSP00000501898.1

Frequencies

GnomAD3 genomes Cov.: 29

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 29

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Uncertain:1

May 31, 2024

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.196-205_250del variant results from a deletion of 260 nucleotides between positions c.196-205 and c.250 and involves the canonical splice acceptor site before coding exon 2 of the CCND2 gene. Alterations that disrupt the canonical splice site are expected to result in aberrant splicing. The resulting transcript is predicted to be in-frame and is not expected to trigger nonsense-mediated mRNA decay; however, direct evidence is unavailable. The exact functional effect of the altered amino acid sequence is unknown. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site and will result in the creation or strengthening of a novel splice acceptor site. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr12-4384961;