12-4275795-ATACCAAAGCACTGATGGGCTATTCTGATTCACTCCAGTTTCCTCATCTTTGTTCTTTATTCTTATCACGCATTCTGGTCCCCTCCCCCTCCCACAAAAAAAAATTAATTTTTTTTGTTTCGATAGATTACGCTTTTTTATTCTTTTTCTCTTTTGCTGATGCTATGCTCTCCACCCCCGCCCCCCAACCCTTTCCCACTCCCATTATAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCCATGAAT-A
Variant summary
Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2
The NM_001759.4(CCND2):c.196-205_250del(p.Val66fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 29)
Consequence
CCND2
NM_001759.4 frameshift, splice_acceptor, splice_region, intron
NM_001759.4 frameshift, splice_acceptor, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 1.06
Genes affected
CCND2 (HGNC:1583): (cyclin D2) The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK4 or CDK6 and functions as a regulatory subunit of the complex, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. Knockout studies of the homologous gene in mouse suggest the essential roles of this gene in ovarian granulosa and germ cell proliferation. High level expression of this gene was observed in ovarian and testicular tumors. Mutations in this gene are associated with megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (MPPH3). [provided by RefSeq, Sep 2014]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 10 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CCND2 | NM_001759.4 | c.196-205_250del | p.Val66fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | 2/5 | ENST00000261254.8 | NP_001750.1 | |
CCND2-AS1 | NR_125790.1 | n.126+4_126+263del | splice_region_variant, intron_variant |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CCND2 | ENST00000261254.8 | c.196-205_250del | p.Val66fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | 2/5 | 1 | NM_001759.4 | ENSP00000261254.3 | ||
ENSG00000285901 | ENST00000674624.1 | n.196-205_250del | splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant | 2/10 | ENSP00000501898.1 |
Frequencies
GnomAD3 genomes Cov.: 29
GnomAD3 genomes
Cov.:
29
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 29
GnomAD4 genome
Cov.:
29
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Inborn genetic diseases Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Ambry Genetics | May 31, 2024 | The c.196-205_250del variant results from a deletion of 260 nucleotides between positions c.196-205 and c.250 and involves the canonical splice acceptor site before coding exon 2 of the CCND2 gene. Alterations that disrupt the canonical splice site are expected to result in aberrant splicing. The resulting transcript is predicted to be in-frame and is not expected to trigger nonsense-mediated mRNA decay; however, direct evidence is unavailable. The exact functional effect of the altered amino acid sequence is unknown. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). In silico splice site analysis predicts that this alteration will weaken the native splice acceptor site and will result in the creation or strengthening of a novel splice acceptor site. Based on insufficient or conflicting evidence, the clinical significance of this alteration remains unclear. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.