1-10639079-GGTCCTCGTCGTCGTCGTCCTCGTCGTC-G

Position:

• chr1-10639079-GGTCCTCGTCGTCGTCGTCCTCGTCGTC-G

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4 BS2

The NM_001079843.3(CASZ1):​c.5116_5142delGACGACGAGGACGACGACGACGAGGAC​(p.Asp1706_Asp1714del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000873 in 145,512 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.00087 (1 hom., cov: 31)
  • Exomes 𝑓: 0.0010 (2 hom.)
  • Failed GnomAD Quality Control
• Consequence: CASZ1 NM_001079843.3 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 6.05

Genes affected

CASZ1 (HGNC:26002): (castor zinc finger 1) The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001079843.3.
• BS2: High AC in GnomAd4 at 127 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CASZ1	NM_001079843.3	c.5116_5142delGACGACGAGGACGACGACGACGAGGAC	p.Asp1706_Asp1714del	conservative_inframe_deletion	21/21	ENST00000377022.8	NP_001073312.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CASZ1	ENST00000377022.8	c.5116_5142delGACGACGAGGACGACGACGACGAGGAC	p.Asp1706_Asp1714del	conservative_inframe_deletion	21/21	1	NM_001079843.3	ENSP00000366221.3

Frequencies

GnomAD3 genomes AF: 0.000873 AC: 127 AN: 145482 Hom.: 1 Cov.: 31

Gnomad AFR AF: 0.000322

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000408

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00178

Gnomad SAS AF: 0.000651

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00329

Gnomad NFE AF: 0.00144

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000195 AC: 18 AN: 92170 Hom.: 0 AF XY: 0.000151 AC XY: 8 AN XY: 53002

Gnomad AFR exome AF: 0.000461

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000129

Gnomad FIN exome AF: 0.0000713

Gnomad NFE exome AF: 0.000356

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00103 AC: 1032 AN: 999072 Hom.: 2 AF XY: 0.000984 AC XY: 477 AN XY: 484576

Gnomad4 AFR exome AF: 0.000373

Gnomad4 AMR exome AF: 0.000226

Gnomad4 ASJ exome AF: 0.000163

Gnomad4 EAS exome AF: 0.000867

Gnomad4 SAS exome AF: 0.000292

Gnomad4 FIN exome AF: 0.000147

Gnomad4 NFE exome AF: 0.00115

Gnomad4 OTH exome AF: 0.000824

GnomAD4 genome AF: 0.000873 AC: 127 AN: 145512 Hom.: 1 Cov.: 31 AF XY: 0.000763 AC XY: 54 AN XY: 70764

Gnomad4 AFR AF: 0.000321

Gnomad4 AMR AF: 0.000408

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00179

Gnomad4 SAS AF: 0.000652

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00145

Gnomad4 OTH AF: 0.00

Alfa AF: 0.00101 Hom.: 0

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jun 15, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with CASZ1-related conditions. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant, c.5116_5142del, results in the deletion of 9 amino acid(s) of the CASZ1 protein (p.Asp1706_Asp1714del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs776847243; hg19: chr1-10699136;