1-111414925-GGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATAACCCACAGA-G

Position:

• chr1-111414925-GGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATAACCCACAGA-G

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 2P and 10B. PM4 BP6_Moderate BA1

The NM_002557.4(OVGP1):​c.1531_1575delTCTGTGGGTTATCAGTCTGTGACCCCTGGGGAAAAGACCCTGACC​(p.Ser511_Thr525del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.256 in 149,838 control chromosomes in the GnomAD database, including 5,232 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.26 (5232 hom., cov: 22)
  • Exomes 𝑓: 0.29 (67734 hom.)
  • Failed GnomAD Quality Control
• Consequence: OVGP1 NM_002557.4 conservative_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 3.72

Genes affected

OVGP1 (HGNC:8524): (oviductal glycoprotein 1) This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]

LOC124904309 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_002557.4.
• BP6: Variant 1-111414925-GGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATAACCCACAGA-G is Benign according to our data. Variant chr1-111414925-GGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATAACCCACAGA-G is described in ClinVar as [Benign]. Clinvar id is 767687.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.31 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
OVGP1	NM_002557.4	c.1531_1575delTCTGTGGGTTATCAGTCTGTGACCCCTGGGGAAAAGACCCTGACC	p.Ser511_Thr525del	conservative_inframe_deletion	11/11	ENST00000369732.4	NP_002548.3
LOC124904309	XR_007066387.1	n.92-34_102delTTCCCCAGGGGTCACAGACTGATAACCCACAGAGGTCAGGGTCTT		splice_acceptor_variant, splice_region_variant, intron_variant, non_coding_transcript_exon_variant	2/2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
OVGP1	ENST00000369732.4	c.1531_1575delTCTGTGGGTTATCAGTCTGTGACCCCTGGGGAAAAGACCCTGACC	p.Ser511_Thr525del	conservative_inframe_deletion	11/11	1	NM_002557.4	ENSP00000358747.3

Frequencies

GnomAD3 genomes AF: 0.256 AC: 38289 AN: 149740 Hom.: 5231 Cov.: 22

Gnomad AFR AF: 0.186

Gnomad AMI AF: 0.301

Gnomad AMR AF: 0.193

Gnomad ASJ AF: 0.193

Gnomad EAS AF: 0.141

Gnomad SAS AF: 0.308

Gnomad FIN AF: 0.288

Gnomad MID AF: 0.237

Gnomad NFE AF: 0.314

Gnomad OTH AF: 0.242

GnomAD3 exomes AF: 0.256 AC: 63320 AN: 246936 Hom.: 9162 AF XY: 0.265 AC XY: 35294 AN XY: 133406

Gnomad AFR exome AF: 0.175

Gnomad AMR exome AF: 0.133

Gnomad ASJ exome AF: 0.179

Gnomad EAS exome AF: 0.129

Gnomad SAS exome AF: 0.323

Gnomad FIN exome AF: 0.288

Gnomad NFE exome AF: 0.310

Gnomad OTH exome AF: 0.261

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.290 AC: 399157 AN: 1377868 Hom.: 67734 AF XY: 0.293 AC XY: 201052 AN XY: 687120

Gnomad4 AFR exome AF: 0.175

Gnomad4 AMR exome AF: 0.137

Gnomad4 ASJ exome AF: 0.178

Gnomad4 EAS exome AF: 0.137

Gnomad4 SAS exome AF: 0.324

Gnomad4 FIN exome AF: 0.297

Gnomad4 NFE exome AF: 0.307

Gnomad4 OTH exome AF: 0.266

GnomAD4 genome AF: 0.256 AC: 38305 AN: 149838 Hom.: 5232 Cov.: 22 AF XY: 0.256 AC XY: 18719 AN XY: 73236

Gnomad4 AFR AF: 0.186

Gnomad4 AMR AF: 0.192

Gnomad4 ASJ AF: 0.193

Gnomad4 EAS AF: 0.142

Gnomad4 SAS AF: 0.309

Gnomad4 FIN AF: 0.288

Gnomad4 NFE AF: 0.314

Gnomad4 OTH AF: 0.243

Alfa AF: 0.0920 Hom.: 215

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Oct 11, 2019

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs376377993; hg19: chr1-111957547;