1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
Variant summary
Our verdict is Benign. The variant received -7 ACMG points: 0P and 7B. BP3BP6_ModerateBS2
The NM_002249.6(KCNN3):c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC(p.Gln71_Gln80dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).
Frequency
Consequence
NM_002249.6 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Zimmermann-Laband syndrome 3Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- Zimmermann-Laband syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- schizophreniaInheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -7 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002249.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNN3 | NM_002249.6 | MANE Select | c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln71_Gln80dup | conservative_inframe_insertion | Exon 1 of 8 | NP_002240.3 | ||
| KCNN3 | NM_001204087.2 | c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln71_Gln80dup | conservative_inframe_insertion | Exon 1 of 9 | NP_001191016.1 | A0A087WYJ0 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNN3 | ENST00000271915.9 | TSL:1 MANE Select | c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln71_Gln80dup | conservative_inframe_insertion | Exon 1 of 8 | ENSP00000271915.3 | Q9UGI6-1 | |
| KCNN3 | ENST00000618040.4 | TSL:5 | c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln71_Gln80dup | conservative_inframe_insertion | Exon 1 of 9 | ENSP00000481848.1 | A0A087WYJ0 | |
| KCNN3 | ENST00000874071.1 | c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln71_Gln80dup | conservative_inframe_insertion | Exon 1 of 7 | ENSP00000544130.1 |
Frequencies
GnomAD3 genomes AF: 0.00272 AC: 384AN: 141268Hom.: 4 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000484 AC: 661AN: 1365104Hom.: 1 Cov.: 112 AF XY: 0.000507 AC XY: 342AN XY: 674866 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00275 AC: 389AN: 141370Hom.: 4 Cov.: 0 AF XY: 0.00291 AC XY: 198AN XY: 68000 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at