NM_002249.6:c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
• rs3831942
• NM_002249.6:c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Benign. The variant received -7 ACMG points: 0P and 7B. BP3 BP6_Moderate BS2

The NM_002249.6(KCNN3):​c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln71_Gln80dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.0028 (4 hom., cov: 0)
  • Exomes 𝑓: 0.00048 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNN3 NM_002249.6 conservative_inframe_insertion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 2.12
• Publications: 18 publications found

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

KCNN3 Gene-Disease associations (from GenCC):

• Zimmermann-Laband syndrome 3

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Zimmermann-Laband syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• schizophrenia

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000308854 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -7 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_002249.6
• BP6: Variant 1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr1-154869723-G-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT is described in ClinVar as Benign. ClinVar VariationId is 1685494.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Homozygotes in GnomAd4 at 4 Unknown,AD,AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002249.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNN3	NM_002249.6	MANE Select	c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln71_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	NP_002240.3
	KCNN3	NM_001204087.2		c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln71_Gln80dup	conservative_inframe_insertion	Exon 1 of 9	NP_001191016.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNN3	ENST00000271915.9	TSL:1 MANE Select	c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln71_Gln80dup	conservative_inframe_insertion	Exon 1 of 8	ENSP00000271915.3
	KCNN3	ENST00000618040.4	TSL:5	c.212_241dupAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln71_Gln80dup	conservative_inframe_insertion	Exon 1 of 9	ENSP00000481848.1
	ENSG00000308854	ENST00000836873.1		n.195-646_195-617dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.00272 AC: 384 AN: 141268 Hom.: 4 Cov.: 0

Gnomad AFR AF: 0.00666

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000849

Gnomad ASJ AF: 0.000296

Gnomad EAS AF: 0.00259

Gnomad SAS AF: 0.00346

Gnomad FIN AF: 0.000439

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00133

Gnomad OTH AF: 0.00159

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000484 AC: 661 AN: 1365104 Hom.: 1 Cov.: 112 AF XY: 0.000507 AC XY: 342 AN XY: 674866

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00302 AC: 94 AN: 31104

American (AMR) AF: 0.000535 AC: 19 AN: 35514

Ashkenazi Jewish (ASJ) AF: 0.000160 AC: 4 AN: 24960

East Asian (EAS) AF: 0.00163 AC: 58 AN: 35568

South Asian (SAS) AF: 0.00100 AC: 79 AN: 78744

European-Finnish (FIN) AF: 0.000303 AC: 14 AN: 46140

Middle Eastern (MID) AF: 0.000902 AC: 4 AN: 4434

European-Non Finnish (NFE) AF: 0.000341 AC: 359 AN: 1051840

Other (OTH) AF: 0.000528 AC: 30 AN: 56800

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00275 AC: 389 AN: 141370 Hom.: 4 Cov.: 0 AF XY: 0.00291 AC XY: 198 AN XY: 68000

African (AFR) AF: 0.00677 AC: 256 AN: 37828

American (AMR) AF: 0.000848 AC: 12 AN: 14158

Ashkenazi Jewish (ASJ) AF: 0.000296 AC: 1 AN: 3376

East Asian (EAS) AF: 0.00260 AC: 12 AN: 4612

South Asian (SAS) AF: 0.00346 AC: 14 AN: 4042

European-Finnish (FIN) AF: 0.000439 AC: 4 AN: 9120

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 282

European-Non Finnish (NFE) AF: 0.00133 AC: 87 AN: 65180

Other (OTH) AF: 0.00158 AC: 3 AN: 1902

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

May 04, 2022

Mendelics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1
Mutation Taster		=75/25	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199;