1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G

Variant names:

• chr1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G
• rs80356768
• NM_000157.4:c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000157.4(GBA1):​c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC​(p.Leu422ProfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 30)
• Consequence: GBA1 NM_000157.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:8 O:1
• Conservation: PhyloP100: 8.47
• Publications: 15 publications found

Genes affected

GBA1 (HGNC:4177): (glucosylceramidase beta 1) This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]

GBA1 Gene-Disease associations (from GenCC):

• Parkinson disease

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• Gaucher disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health, ClinGen
• Gaucher disease perinatal lethal

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Laboratory for Molecular Medicine, Genomics England PanelApp
• late-onset Parkinson disease

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• Gaucher disease type I

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
• Gaucher disease type II

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• Gaucher disease type III

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G is Pathogenic according to our data. Variant chr1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 193611.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GBA1	NM_000157.4	c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC	p.Leu422ProfsTer4	frameshift_variant	Exon 9 of 11	ENST00000368373.8	NP_000148.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GBA1	ENST00000368373.8	c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC	p.Leu422ProfsTer4	frameshift_variant	Exon 9 of 11	1	NM_000157.4	ENSP00000357357.3

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:8 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:3

May 20, 2014

Eurofins Ntd Llc (ga)

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Dec 18, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Leu422Profs*4) in the GBA gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in GBA are known to be pathogenic (PMID: 9153297, 10079102, 10796875, 11783951). The frequency data for this variant in the population databases (gnomAD) is considered unreliable due to the presence of homologous sequence, such as pseudogenes or paralogs, in the genome. This premature translational stop signal has been observed in individual(s) with Gaucher disease and/or Parkinson disease (PMID: 17395504, 20947659, 28727984). This variant is also known as c.1263_1317del. ClinVar contains an entry for this variant (Variation ID: 193611). For these reasons, this variant has been classified as Pathogenic. -

Mar 07, 2023

Revvity Omics, Revvity

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Gaucher disease Pathogenic:2 Other:1

May 19, 2016

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: The c.1265_1319del55 variant in GBA involves the deletion of 55 nucleotides, resulting in a premature termination codon, predicted to cause a truncated or absent GBA protein due to nonsense mediated decay. This deletion in exon 10 (exon 9 legacy) is thought to be the result of recombination between GBA and GBAP (a GBA pseudogene). The frequency of the variant in the large and diverse ExAC database cannot be determined as the sequencing technology used typically cannot detect deletions this large. However, the variant has been tested in at least 788 controls in the literature and was not found. The variant was reported in the literature in numerous affected individuals, and has been classified by multiple reputable clinical labs/databases as pathogenic. Taken together, this variant has been classified as pathogenic. -

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Aug 17, 2017

Natera, Inc.

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Gaucher disease type I Pathogenic:1

Mar 01, 2000

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Gaucher disease type II;C0268251:Gaucher disease type III;C0752347:Lewy body dementia;C1842704:Gaucher disease perinatal lethal;C1856476:Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome;C1961835:Gaucher disease type I;C3160718:Parkinson disease, late-onset Pathogenic:1

Dec 28, 2021

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Gaucher disease perinatal lethal Pathogenic:1

Mar 01, 2000

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs80356768; hg19: chr1-155205540;