rs80356768

Variant names:

• chr1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G
• rs80356768
• NM_000157.4:c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000157.4(GBA1):​c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC​(p.Leu422ProfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 30)
• Consequence: GBA1 NM_000157.4 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:8 O:1
• Conservation: PhyloP100: 8.47
• Publications: 15 publications found

Genes affected

GBA1 (HGNC:4177): (glucosylceramidase beta 1) This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]

GBA1 Gene-Disease associations (from GenCC):

• Parkinson disease

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• Gaucher disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health, ClinGen
• Gaucher disease perinatal lethal

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Laboratory for Molecular Medicine, G2P
• late-onset Parkinson disease

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
• Gaucher disease type I

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Orphanet
• Gaucher disease type II

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• Gaucher disease type III

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet
• Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G is Pathogenic according to our data. Variant chr1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 193611.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000157.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GBA1	NM_000157.4	MANE Select	c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC	p.Leu422ProfsTer4	frameshift	Exon 9 of 11	NP_000148.2	P04062-1
	GBA1	NM_001005741.3		c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC	p.Leu422ProfsTer4	frameshift	Exon 10 of 12	NP_001005741.1	P04062-1
	GBA1	NM_001005742.3		c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC	p.Leu422ProfsTer4	frameshift	Exon 10 of 12	NP_001005742.1	P04062-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GBA1	ENST00000368373.8	TSL:1 MANE Select	c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC	p.Leu422ProfsTer4	frameshift	Exon 9 of 11	ENSP00000357357.3	P04062-1
	GBA1	ENST00000327247.9	TSL:1	c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC	p.Leu422ProfsTer4	frameshift	Exon 10 of 12	ENSP00000314508.5	P04062-1
	GBA1	ENST00000948997.1		c.1331_1385delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC	p.Leu444ProfsTer4	frameshift	Exon 11 of 13	ENSP00000619056.1

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	not provided (3)
2	-	-	Gaucher disease (3)
1	-	-	Gaucher disease perinatal lethal (1)
1	-	-	Gaucher disease type I (1)
1	-	-	Gaucher disease type II;C0268251:Gaucher disease type III;C0752347:Lewy body dementia;C1842704:Gaucher disease perinatal lethal;C1856476:Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome;C1961835:Gaucher disease type I;C3160718:Parkinson disease, late-onset (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs80356768; hg19: chr1-155205540;