rs80356768
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000157.4(GBA1):c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC(p.Leu422fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 30)
Consequence
GBA1
NM_000157.4 frameshift
NM_000157.4 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 8.47
Genes affected
GBA1 (HGNC:4177): (glucosylceramidase beta 1) This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G is Pathogenic according to our data. Variant chr1-155235749-GGGACTGTCGACAAAGTTACGCACCCAATTGGGTCCTCCTTCGGGGTTCAGGGCAA-G is described in ClinVar as [Pathogenic]. Clinvar id is 193611.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
GBA1 | NM_000157.4 | c.1265_1319delTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCC | p.Leu422fs | frameshift_variant | 9/11 | ENST00000368373.8 | NP_000148.2 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD3 genomes
Cov.:
30
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 30
GnomAD4 genome
Cov.:
30
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:8Other:1
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
not provided Pathogenic:3
Pathogenic, criteria provided, single submitter | clinical testing | Eurofins Ntd Llc (ga) | May 20, 2014 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Revvity Omics, Revvity | Mar 07, 2023 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 23, 2024 | This sequence change creates a premature translational stop signal (p.Leu422Profs*4) in the GBA gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in GBA are known to be pathogenic (PMID: 9153297, 10079102, 10796875, 11783951). The frequency data for this variant in the population databases (gnomAD) is considered unreliable due to the presence of homologous sequence, such as pseudogenes or paralogs, in the genome. This premature translational stop signal has been observed in individual(s) with Gaucher disease and/or Parkinson's disease (PMID: 17395504, 20947659, 28727984). This variant is also known as c.1263_1317del. ClinVar contains an entry for this variant (Variation ID: 193611). For these reasons, this variant has been classified as Pathogenic. - |
Gaucher disease Pathogenic:2Other:1
Pathogenic, no assertion criteria provided | clinical testing | Natera, Inc. | Aug 17, 2017 | - - |
not provided, no classification provided | literature only | GeneReviews | - | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Women's Health and Genetics/Laboratory Corporation of America, LabCorp | May 19, 2016 | Variant summary: The c.1265_1319del55 variant in GBA involves the deletion of 55 nucleotides, resulting in a premature termination codon, predicted to cause a truncated or absent GBA protein due to nonsense mediated decay. This deletion in exon 10 (exon 9 legacy) is thought to be the result of recombination between GBA and GBAP (a GBA pseudogene). The frequency of the variant in the large and diverse ExAC database cannot be determined as the sequencing technology used typically cannot detect deletions this large. However, the variant has been tested in at least 788 controls in the literature and was not found. The variant was reported in the literature in numerous affected individuals, and has been classified by multiple reputable clinical labs/databases as pathogenic. Taken together, this variant has been classified as pathogenic. - |
Gaucher disease type I Pathogenic:1
Pathogenic, no assertion criteria provided | literature only | OMIM | Mar 01, 2000 | - - |
Gaucher disease type II;C0268251:Gaucher disease type III;C0752347:Lewy body dementia;C1842704:Gaucher disease perinatal lethal;C1856476:Gaucher disease-ophthalmoplegia-cardiovascular calcification syndrome;C1961835:Gaucher disease type I;C3160718:Parkinson disease, late-onset Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Fulgent Genetics, Fulgent Genetics | Dec 28, 2021 | - - |
Gaucher disease perinatal lethal Pathogenic:1
Pathogenic, no assertion criteria provided | literature only | OMIM | Mar 01, 2000 | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at