1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T

Position:

• chr1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_020451.3(SELENON):​c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG​(p.Ala4fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000311 in 772,332 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R3R) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000014 (0 hom., cov: 30)
  • Exomes 𝑓: 0.000035 (0 hom.)
• Consequence: SELENON NM_020451.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:4
• Conservation: PhyloP100: 1.67

Genes affected

SELENON (HGNC:15999): (selenoprotein N) This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in this gene are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. SEPN1-related myopathy consists of 4 autosomal recessive disorders, originally thought to be separate entities: rigid spine muscular dystrophy (RSMD1), the classical form of multiminicore disease, desmin related myopathy with Mallory-body like inclusions, and congenital fiber-type disproportion (CFTD). This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2016]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 144 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T is Pathogenic according to our data. Variant chr1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T is described in ClinVar as [Pathogenic]. Clinvar id is 280406.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T is described in Lovd as [Likely_pathogenic]. Variant chr1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SELENON	NM_020451.3	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4fs	frameshift_variant	1/13	ENST00000361547.7	NP_065184.2
SELENON	NM_206926.2	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4fs	frameshift_variant	1/12		NP_996809.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SELENON	ENST00000361547.7	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4fs	frameshift_variant	1/13	1	NM_020451.3	ENSP00000355141.2
SELENON	ENST00000374315.1	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4fs	frameshift_variant	1/12	5		ENSP00000363434.1
SELENON	ENST00000354177.9	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4fs	frameshift_variant	1/12	5		ENSP00000346109.5
SELENON	ENST00000494537.2	n.9_33delGGCCCGGCCGGGCCAACGCGGGCCG		non_coding_transcript_exon_variant	1/13	3		ENSP00000508308.1

Frequencies

GnomAD3 genomes AF: 0.0000139 AC: 2 AN: 143788 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000307

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000350 AC: 22 AN: 628544 Hom.: 0 AF XY: 0.0000376 AC XY: 11 AN XY: 292422

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000366

Gnomad4 OTH exome AF: 0.0000487

GnomAD4 genome AF: 0.0000139 AC: 2 AN: 143788 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 69862

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000307

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000227

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Eichsfeld type congenital muscular dystrophy Pathogenic:3

Pathogenic, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Mar 17, 2023	Variant summary: SELENON c.9_33del25 (p.Ala4ProfsX54) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant was absent in 24242 control chromosomes (gnomAD). c.9_33del25 has been reported in the literature in at least two compound heterozygous individuals affected with selenoprotein N-related myopathy (Scoto_2011). These data indicate that the variant may be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Two ClinVar submitters have assessed the variant since 2014: both classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -
Pathogenic, criteria provided, single submitter	clinical testing	Fulgent Genetics, Fulgent Genetics	Feb 15, 2024	- -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Jun 27, 2022	The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This sequence change creates a premature translational stop signal (p.Ala4Profs*54) in the SELENON gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SELENON are known to be pathogenic (PMID: 21131290, 21670436). This variant has not been reported in the literature in individuals affected with SELENON-related conditions. For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 280406). -

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

GeneDx

Jun 05, 2023

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs886041619; hg19: chr1-26126723;