NM_020451.3:c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG

Variant names:

• chr1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T
• rs886041619
• NM_020451.3:c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_020451.3(SELENON):​c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG​(p.Ala4ProfsTer54) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000311 in 772,332 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R3R) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000014 (0 hom., cov: 30)
  • Exomes 𝑓: 0.000035 (0 hom.)
• Consequence: SELENON NM_020451.3 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 1.67
• Publications: 0 publications found

Genes affected

SELENON (HGNC:15999): (selenoprotein N) This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in this gene are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. SEPN1-related myopathy consists of 4 autosomal recessive disorders, originally thought to be separate entities: rigid spine muscular dystrophy (RSMD1), the classical form of multiminicore disease, desmin related myopathy with Mallory-body like inclusions, and congenital fiber-type disproportion (CFTD). This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2016]

SELENON Gene-Disease associations (from GenCC):

• rigid spine muscular dystrophy 1

  Inheritance: AR Classification: DEFINITIVE Submitted by: Ambry Genetics, G2P
• SELENON-related myopathy

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• congenital myopathy 4A, autosomal dominant

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• congenital fiber-type disproportion myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• desmin-related myopathy with Mallory body-like inclusions

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• rigid spine syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 76 pathogenic variants in the truncated region.
• PP5: Variant 1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T is Pathogenic according to our data. Variant chr1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 280406.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SELENON	NM_020451.3	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4ProfsTer54	frameshift_variant	Exon 1 of 13	ENST00000361547.7	NP_065184.2
SELENON	NM_206926.2	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4ProfsTer54	frameshift_variant	Exon 1 of 12		NP_996809.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SELENON	ENST00000361547.7	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4ProfsTer54	frameshift_variant	Exon 1 of 13	1	NM_020451.3	ENSP00000355141.2
SELENON	ENST00000374315.1	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4ProfsTer54	frameshift_variant	Exon 1 of 12	5		ENSP00000363434.1
SELENON	ENST00000354177.9	c.9_33delGGCCCGGCCGGGCCAACGCGGGCCG	p.Ala4ProfsTer54	frameshift_variant	Exon 1 of 12	5		ENSP00000346109.5
SELENON	ENST00000494537.2	n.9_33delGGCCCGGCCGGGCCAACGCGGGCCG		non_coding_transcript_exon_variant	Exon 1 of 13	3		ENSP00000508308.1

Frequencies

GnomAD3 genomes AF: 0.0000139 AC: 2 AN: 143788 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000307

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000350 AC: 22 AN: 628544 Hom.: 0 AF XY: 0.0000376 AC XY: 11 AN XY: 292422

African (AFR) AF: 0.00 AC: 0 AN: 11876

American (AMR) AF: 0.00 AC: 0 AN: 724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3866

East Asian (EAS) AF: 0.00 AC: 0 AN: 2686

South Asian (SAS) AF: 0.00 AC: 0 AN: 13106

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 214

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1248

European-Non Finnish (NFE) AF: 0.0000366 AC: 21 AN: 574274

Other (OTH) AF: 0.0000487 AC: 1 AN: 20550

GnomAD4 genome AF: 0.0000139 AC: 2 AN: 143788 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 69862

African (AFR) AF: 0.00 AC: 0 AN: 40206

American (AMR) AF: 0.00 AC: 0 AN: 14556

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3360

East Asian (EAS) AF: 0.00 AC: 0 AN: 4882

South Asian (SAS) AF: 0.00 AC: 0 AN: 4540

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 7942

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 310

European-Non Finnish (NFE) AF: 0.0000307 AC: 2 AN: 65102

Other (OTH) AF: 0.00 AC: 0 AN: 1988

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000227

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Eichsfeld type congenital muscular dystrophy Pathogenic:4

Feb 15, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Mar 17, 2023

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: SELENON c.9_33del25 (p.Ala4ProfsX54) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant was absent in 24242 control chromosomes (gnomAD). c.9_33del25 has been reported in the literature in at least two compound heterozygous individuals affected with selenoprotein N-related myopathy (Scoto_2011). These data indicate that the variant may be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Two ClinVar submitters have assessed the variant since 2014: both classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Apr 29, 2025

Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: curation

The heterozygous p.Ala4ProfsTer? variant in SELENON has been reported in 2 unrelated individuals with rigid spine muscular dystrophy 1 (PMID: 21670436), and has been identified in 0.004% (23/639376) of European (non-Finnish) chromosomes by the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitute.org; dbSNP rs886041619). Although this variant has been seen in the general population in a heterozygous state, its frequency is low enough to be consistent with a recessive carrier frequency. This variant has been reported in ClinVar (VCV000280406.12) and has been interpreted as Pathogenic by GeneDx, Women's Health and Genetics/Laboratory Corporation of America, and Labcorp Genetics (formerly Invitae). This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position and leads to a premature termination codon downstream. This alteration is then predicted to lead to a truncated or absent protein. Loss of function of the SELENON gene is an established disease mechanism in autosomal recessive rigid spine muscular dystrophy 1. In summary, although additional studies are required to fully establish its clinical significance, this variant is likely pathogenic for autosomal recessive rigid spine muscular dystrophy 1. ACMG/AMP Criteria applied: PVS1, PM2_supporting (Richards 2015). -

Jun 27, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Ala4Profs*54) in the SELENON gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SELENON are known to be pathogenic (PMID: 21131290, 21670436). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with SELENON-related conditions. ClinVar contains an entry for this variant (Variation ID: 280406). For these reasons, this variant has been classified as Pathogenic. -

not provided Pathogenic:1

Jun 05, 2023

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7
Mutation Taster		=11/189	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs886041619; hg19: chr1-26126723;