1-26282328-A-AGGGACTGGGGCCGGGACCGGGACC

Position:

• chr1-26282328-A-AGGGACTGGGGCCGGGACCGGGACC

Variant summary

Our verdict is Benign. Variant got -9 ACMG points: 0P and 9B. BP3 BA1

The NM_001389556.1(UBXN11):​c.1510_1533dupGGTCCCGGTCCCGGCCCCAGTCCC​(p.Pro511_Cys512insGlyProGlyProGlyProSerPro) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.084 (183 hom., cov: 0)
  • Exomes 𝑓: 0.026 (1982 hom.)
• Consequence: UBXN11 NM_001389556.1 conservative_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: 0.00600

Genes affected

UBXN11 (HGNC:30600): (UBX domain protein 11) This gene encodes a protein with a divergent C-terminal UBX domain. The homologous protein in the rat interacts with members of the Rnd subfamily of Rho GTPases at the cell periphery through its C-terminal region. It also interacts with several heterotrimeric G proteins through their G-alpha subunits and promotes Rho GTPase activation. It is proposed to serve a bidirectional role in the promotion and inhibition of Rho activity through upstream signaling pathways. The 3' coding sequence of this gene contains a polymoprhic region of 24 nt tandem repeats. Several transcripts containing between 1.5 and five repeat units have been reported. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

UBXN11 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -9 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001389556.1
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.29 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
UBXN11	NM_001389556.1	c.1510_1533dupGGTCCCGGTCCCGGCCCCAGTCCC	p.Pro511_Cys512insGlyProGlyProGlyProSerPro	conservative_inframe_insertion	15/15	ENST00000374222.6	NP_001376485.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
UBXN11	ENST00000374222.6	c.1510_1533dupGGTCCCGGTCCCGGCCCCAGTCCC	p.Pro511_Cys512insGlyProGlyProGlyProSerPro	conservative_inframe_insertion	15/15	5	NM_001389556.1	ENSP00000363339.1

Frequencies

GnomAD3 genomes AF: 0.0833 AC: 2865 AN: 34400 Hom.: 179 Cov.: 0

Gnomad AFR AF: 0.0883

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.121

Gnomad ASJ AF: 0.0409

Gnomad EAS AF: 0.310

Gnomad SAS AF: 0.126

Gnomad FIN AF: 0.110

Gnomad MID AF: 0.0833

Gnomad NFE AF: 0.0255

Gnomad OTH AF: 0.102

GnomAD3 exomes AF: 0.0232 AC: 2192 AN: 94654 Hom.: 258 AF XY: 0.0221 AC XY: 1190 AN XY: 53796

Gnomad AFR exome AF: 0.0215

Gnomad AMR exome AF: 0.0379

Gnomad ASJ exome AF: 0.00198

Gnomad EAS exome AF: 0.204

Gnomad SAS exome AF: 0.0378

Gnomad FIN exome AF: 0.00442

Gnomad NFE exome AF: 0.00209

Gnomad OTH exome AF: 0.0188

GnomAD4 exome AF: 0.0259 AC: 19141 AN: 738720 Hom.: 1982 Cov.: 7 AF XY: 0.0298 AC XY: 10575 AN XY: 354678

Gnomad4 AFR exome AF: 0.0384

Gnomad4 AMR exome AF: 0.0963

Gnomad4 ASJ exome AF: 0.0203

Gnomad4 EAS exome AF: 0.326

Gnomad4 SAS exome AF: 0.0927

Gnomad4 FIN exome AF: 0.110

Gnomad4 NFE exome AF: 0.00421

Gnomad4 OTH exome AF: 0.0403

GnomAD4 genome AF: 0.0835 AC: 2878 AN: 34454 Hom.: 183 Cov.: 0 AF XY: 0.0854 AC XY: 1465 AN XY: 17160

Gnomad4 AFR AF: 0.0888

Gnomad4 AMR AF: 0.122

Gnomad4 ASJ AF: 0.0409

Gnomad4 EAS AF: 0.311

Gnomad4 SAS AF: 0.122

Gnomad4 FIN AF: 0.110

Gnomad4 NFE AF: 0.0255

Gnomad4 OTH AF: 0.118

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: no assertion criteria provided

Submissions by phenotype

Lung cancer Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Hepatocellular carcinoma Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs66614970; hg19: chr1-26608819;