1-26282328-A-AGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGACC

Position:

• chr1-26282328-A-AGGGACTGGGGCCGGGACCGGGACCGGGACTGGGGCCGGGACCGGGACC

Variant summary

Our verdict is Likely benign. Variant got -1 ACMG points: 0P and 1B. BP3

The NM_001389556.1(UBXN11):​c.1486_1533dupGGTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCC​(p.Pro511_Cys512insGlyProGlyProGlyProSerProGlyProGlyProGlyProSerPro) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0088 (34 hom., cov: 0)
  • Exomes 𝑓: 0.0061 (236 hom.)
  • Failed GnomAD Quality Control
• Consequence: UBXN11 NM_001389556.1 conservative_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:2
• Conservation: PhyloP100: 0.00600

Genes affected

UBXN11 (HGNC:30600): (UBX domain protein 11) This gene encodes a protein with a divergent C-terminal UBX domain. The homologous protein in the rat interacts with members of the Rnd subfamily of Rho GTPases at the cell periphery through its C-terminal region. It also interacts with several heterotrimeric G proteins through their G-alpha subunits and promotes Rho GTPase activation. It is proposed to serve a bidirectional role in the promotion and inhibition of Rho activity through upstream signaling pathways. The 3' coding sequence of this gene contains a polymoprhic region of 24 nt tandem repeats. Several transcripts containing between 1.5 and five repeat units have been reported. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

UBXN11 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001389556.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
UBXN11	NM_001389556.1	c.1486_1533dupGGTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCC	p.Pro511_Cys512insGlyProGlyProGlyProSerProGlyProGlyProGlyProSerPro	conservative_inframe_insertion	15/15	ENST00000374222.6	NP_001376485.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
UBXN11	ENST00000374222.6	c.1486_1533dupGGTCCCGGTCCCGGCCCCAGTCCCGGTCCCGGTCCCGGCCCCAGTCCC	p.Pro511_Cys512insGlyProGlyProGlyProSerProGlyProGlyProGlyProSerPro	conservative_inframe_insertion	15/15	5	NM_001389556.1	ENSP00000363339.1

Frequencies

GnomAD3 genomes AF: 0.00 AC: 320 AN: 36076 Hom.: 35 Cov.: 0 FAILED QC

Gnomad AFR AF: 0.00186

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0495

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.0324

Gnomad SAS AF: 0.00307

Gnomad FIN AF: 0.00135

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00139

Gnomad OTH AF: 0.00377

GnomAD3 exomes AF: 0.00332 AC: 314 AN: 94654 Hom.: 33 AF XY: 0.00286 AC XY: 154 AN XY: 53796

Gnomad AFR exome AF: 0.000131

Gnomad AMR exome AF: 0.0142

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0270

Gnomad SAS exome AF: 0.000973

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000385

Gnomad OTH exome AF: 0.00289

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00615 AC: 4561 AN: 741696 Hom.: 236 Cov.: 7 AF XY: 0.00643 AC XY: 2292 AN XY: 356588

Gnomad4 AFR exome AF: 0.00219

Gnomad4 AMR exome AF: 0.0854

Gnomad4 ASJ exome AF: 0.00194

Gnomad4 EAS exome AF: 0.0964

Gnomad4 SAS exome AF: 0.00318

Gnomad4 FIN exome AF: 0.000637

Gnomad4 NFE exome AF: 0.00105

Gnomad4 OTH exome AF: 0.00885

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00880 AC: 318 AN: 36144 Hom.: 34 Cov.: 0 AF XY: 0.0101 AC XY: 182 AN XY: 18032

Gnomad4 AFR AF: 0.00185

Gnomad4 AMR AF: 0.0496

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.0310

Gnomad4 SAS AF: 0.00307

Gnomad4 FIN AF: 0.00135

Gnomad4 NFE AF: 0.00139

Gnomad4 OTH AF: 0.00362

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: no assertion criteria provided

Submissions by phenotype

Lung cancer Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Hepatocellular carcinoma Pathogenic:1

Pathogenic, no assertion criteria provided

research

Arun Kumar Laboratory, Indian Institute of Science

Jun 15, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs66614970; hg19: chr1-26608819;