1-33012389-GGTTTTCATCATGGGTTAGAAAACAAAATGGAATTCTCTGTCCATAATGTGCCATCAGGAACTGTGACCCTGCCTGACTTCACATGATCCTGGACTTCTAATCAGCTGCTGGAAATGGAAGAAATACTATGAGGTTCTGGAATTGCGGTCCCTGGAAGATTACCTGGGTTAGTTCATTTTGGTCAAAAAATAAAATCAAAAGTATGGTTAAAGAAGTAAACAGCTGGGCTGGGTGTAGTGGCTCACGTCTGTGATCCTGGCACTTCAGGAGGCCAAGGTGGGTGGATTGCTTAAGCCTAGGAGTTCAAGACCAGCCTGGGCAACTTGGCAAAATCCTGTCTCTACAAAAAATACAAATATCAGCCAGGTGTTGTGGCATGCACCTGTAGTCCCAGCTGCTCAGGAGGCTGAGGTGGGATAATTGCTTGAGCCCCAGGAGGCAGAGGTTGCCGTGAGCCAAGATCACGCCACTGCACTCCAGCCAGGGTGGCAGAGCGAAACCTTGTCTCAAAACAACAACAAAAAAGAAGTAAACAGCTGGTAAAGCAACCTAGCCTAAAACTTACAAAGTAGCAGAGTGAACACATATGTGCATGCACACACACACACACACAACACACATACACACAGATGAGAGTAGCACACACGCCAAAGATACATCAAGCAAGTGCTTTTTTAATCAATACATCAAATGATATTTTTGCTAGCCTGAGGAAGCTTCTCTTTGCCTGTCCTATCATTCCCACCCATTGCCTCACAGGGATGGAAAGAAATTCCTTCTTGGACCCAACATTAGATAAACATAACCAAGTCTTTACATGTGGCTTTGGAGAAGGCTGCTAGGATGCTTGCGAACACGACATCGGGGGTCTGGGAT-G

Position:

• chr1-33012389-GGTTTTCATCATGGGTTAGAAAACAAAATGGAATTCTCTGTCCATAATGTGCCATCAGGAACTGTGACCCTGCCTGACTTCACATGATCCTGGACTTCTAATCAGCTGCTGGAAATGGAAGAAATACTATGAGGTTCTGGAATTGCGGTCCCTGGAAGATTACCTGGGTTAGTTCATTTTGGTCAAAAAATAAAATCAAAAGTATGGTTAAAGAAGTAAACAGCTGGGCTGGGTGTAGTGGCTCACGTCTGTGATCCTGGCACTTCAGGAGGCCAAGGTGGGTGGATTGCTTAAGCCTAGGAGTTCAAGACCAGCCTGGGCAACTTGGCAAAATCCTGTCTCTACAAAAAATACAAATATCAGCCAGGTGTTGTGGCATGCACCTGTAGTCCCAGCTGCTCAGGAGGCTGAGGTGGGATAATTGCTTGAGCCCCAGGAGGCAGAGGTTGCCGTGAGCCAAGATCACGCCACTGCACTCCAGCCAGGGTGGCAGAGCGAAACCTTGTCTCAAAACAACAACAAAAAAGAAGTAAACAGCTGGTAAAGCAACCTAGCCTAAAACTTACAAAGTAGCAGAGTGAACACATATGTGCATGCACACACACACACACACAACACACATACACACAGATGAGAGTAGCACACACGCCAAAGATACATCAAGCAAGTGCTTTTTTAATCAATACATCAAATGATATTTTTGCTAGCCTGAGGAAGCTTCTCTTTGCCTGTCCTATCATTCCCACCCATTGCCTCACAGGGATGGAAAGAAATTCCTTCTTGGACCCAACATTAGATAAACATAACCAAGTCTTTACATGTGGCTTTGGAGAAGGCTGCTAGGATGCTTGCGAACACGACATCGGGGGTCTGGGAT-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The ENST00000373449.7(AK2):​c.636_694+817del variant causes a splice donor, splice donor 5th base, coding sequence, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: AK2 ENST00000373449.7 splice_donor, splice_donor_5th_base, coding_sequence, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.99

Genes affected

AK2 (HGNC:362): (adenylate kinase 2) Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]

(HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates 0.09012875536480691 fraction of the geneNo cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
AK2	NM_001625.4	c.636_*791del		stop_lost, 3_prime_UTR_variant	6/6	ENST00000672715.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
AK2	ENST00000672715.1	c.636_*791del		stop_lost, 3_prime_UTR_variant	6/6		NM_001625.4	P3
	ENST00000427524.1	n.246-18644_246-17769del		intron_variant, non_coding_transcript_variant		2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Reticular dysgenesis Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Nov 09, 2018

Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. A similar variant (c.636_*2601del) has been observed to be homozygous in an individual affected with reticular dysgenesis (PMID: 19043417). This variant is not present in population databases (ExAC no frequency). This variant is a deletion of the genomic region encompassing part of exon 6, and extending to the 3' untranslated region of the AK2 gene (c.636_*4954del). While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated protein product or disrupt mRNA translation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1570186429; hg19: chr1-33477990;