1-33012389-GGTTTTCATCATGGGTTAGAAAACAAAATGGAATTCTCTGTCCATAATGTGCCATCAGGAACTGTGACCCTGCCTGACTTCACATGATCCTGGACTTCTAATCAGCTGCTGGAAATGGAAGAAATACTATGAGGTTCTGGAATTGCGGTCCCTGGAAGATTACCTGGGTTAGTTCATTTTGGTCAAAAAATAAAATCAAAAGTATGGTTAAAGAAGTAAACAGCTGGGCTGGGTGTAGTGGCTCACGTCTGTGATCCTGGCACTTCAGGAGGCCAAGGTGGGTGGATTGCTTAAGCCTAGGAGTTCAAGACCAGCCTGGGCAACTTGGCAAAATCCTGTCTCTACAAAAAATACAAATATCAGCCAGGTGTTGTGGCATGCACCTGTAGTCCCAGCTGCTCAGGAGGCTGAGGTGGGATAATTGCTTGAGCCCCAGGAGGCAGAGGTTGCCGTGAGCCAAGATCACGCCACTGCACTCCAGCCAGGGTGGCAGAGCGAAACCTTGTCTCAAAACAACAACAAAAAAGAAGTAAACAGCTGGTAAAGCAACCTAGCCTAAAACTTACAAAGTAGCAGAGTGAACACATATGTGCATGCACACACACACACACACAACACACATACACACAGATGAGAGTAGCACACACGCCAAAGATACATCAAGCAAGTGCTTTTTTAATCAATACATCAAATGATATTTTTGCTAGCCTGAGGAAGCTTCTCTTTGCCTGTCCTATCATTCCCACCCATTGCCTCACAGGGATGGAAAGAAATTCCTTCTTGGACCCAACATTAGATAAACATAACCAAGTCTTTACATGTGGCTTTGGAGAAGGCTGCTAGGATGCTTGCGAACACGACATCGGGGGTCTGGGAT-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_ModeratePM2

The ENST00000373449.7(AK2):​c.636_694+817del variant causes a splice donor, splice donor 5th base, coding sequence, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

AK2
ENST00000373449.7 splice_donor, splice_donor_5th_base, coding_sequence, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 2.99
Variant links:
Genes affected
AK2 (HGNC:362): (adenylate kinase 2) Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates 0.09012875536480691 fraction of the geneNo cryptic splice site detected. Exon removal results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
AK2NM_001625.4 linkuse as main transcriptc.636_*791del stop_lost, 3_prime_UTR_variant 6/6 ENST00000672715.1 NP_001616.1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
AK2ENST00000672715.1 linkuse as main transcriptc.636_*791del stop_lost, 3_prime_UTR_variant 6/6 NM_001625.4 ENSP00000499935 P3P54819-1
ENST00000427524.1 linkuse as main transcriptn.246-18644_246-17769del intron_variant, non_coding_transcript_variant 2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Reticular dysgenesis Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpNov 09, 2018Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. A similar variant (c.636_*2601del) has been observed to be homozygous in an individual affected with reticular dysgenesis (PMID: 19043417). This variant is not present in population databases (ExAC no frequency). This variant is a deletion of the genomic region encompassing part of exon 6, and extending to the 3' untranslated region of the AK2 gene (c.636_*4954del). While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated protein product or disrupt mRNA translation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1570186429; hg19: chr1-33477990; API