1-33012389-GGTTTTCATCATGGGTTAGAAAACAAAATGGAATTCTCTGTCCATAATGTGCCATCAGGAACTGTGACCCTGCCTGACTTCACATGATCCTGGACTTCTAATCAGCTGCTGGAAATGGAAGAAATACTATGAGGTTCTGGAATTGCGGTCCCTGGAAGATTACCTGGGTTAGTTCATTTTGGTCAAAAAATAAAATCAAAAGTATGGTTAAAGAAGTAAACAGCTGGGCTGGGTGTAGTGGCTCACGTCTGTGATCCTGGCACTTCAGGAGGCCAAGGTGGGTGGATTGCTTAAGCCTAGGAGTTCAAGACCAGCCTGGGCAACTTGGCAAAATCCTGTCTCTACAAAAAATACAAATATCAGCCAGGTGTTGTGGCATGCACCTGTAGTCCCAGCTGCTCAGGAGGCTGAGGTGGGATAATTGCTTGAGCCCCAGGAGGCAGAGGTTGCCGTGAGCCAAGATCACGCCACTGCACTCCAGCCAGGGTGGCAGAGCGAAACCTTGTCTCAAAACAACAACAAAAAAGAAGTAAACAGCTGGTAAAGCAACCTAGCCTAAAACTTACAAAGTAGCAGAGTGAACACATATGTGCATGCACACACACACACACACAACACACATACACACAGATGAGAGTAGCACACACGCCAAAGATACATCAAGCAAGTGCTTTTTTAATCAATACATCAAATGATATTTTTGCTAGCCTGAGGAAGCTTCTCTTTGCCTGTCCTATCATTCCCACCCATTGCCTCACAGGGATGGAAAGAAATTCCTTCTTGGACCCAACATTAGATAAACATAACCAAGTCTTTACATGTGGCTTTGGAGAAGGCTGCTAGGATGCTTGCGAACACGACATCGGGGGTCTGGGAT-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2

The NM_001625.4(AK2):​c.636_*791del​(p.Ala212_Ter240delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

AK2
NM_001625.4 stop_lost, conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 2.99
Variant links:
Genes affected
AK2 (HGNC:362): (adenylate kinase 2) Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PVS1
Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
AK2NM_001625.4 linkc.636_*791del p.Ala212_Ter240delins??? stop_lost, conservative_inframe_deletion 6/6 ENST00000672715.1 NP_001616.1 P54819-1A0A140VK93
AK2NM_001625.4 linkc.635_*791del 3_prime_UTR_variant 6/6 ENST00000672715.1 NP_001616.1 P54819-1A0A140VK93

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
AK2ENST00000672715.1 linkc.636_*791del p.Ala212_Ter240delins??? stop_lost, conservative_inframe_deletion 6/6 NM_001625.4 ENSP00000499935.1 P54819-1
AK2ENST00000672715 linkc.635_*791del 3_prime_UTR_variant 6/6 NM_001625.4 ENSP00000499935.1 P54819-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Reticular dysgenesis Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpNov 09, 2018Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acids is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. A similar variant (c.636_*2601del) has been observed to be homozygous in an individual affected with reticular dysgenesis (PMID: 19043417). This variant is not present in population databases (ExAC no frequency). This variant is a deletion of the genomic region encompassing part of exon 6, and extending to the 3' untranslated region of the AK2 gene (c.636_*4954del). While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated protein product or disrupt mRNA translation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1570186429; hg19: chr1-33477990; API