1-8361236-C-CCCTGGAGGAGCTGAGGAGGGAG

Position:

• chr1-8361236-C-CCCTGGAGGAGCTGAGGAGGGAG

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_001042681.2(RERE):​c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG​(p.Thr758fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: RERE NM_001042681.2 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.76

Genes affected

RERE (HGNC:9965): (arginine-glutamic acid dipeptide repeats) This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-8361236-C-CCCTGGAGGAGCTGAGGAGGGAG is Pathogenic according to our data. Variant chr1-8361236-C-CCCTGGAGGAGCTGAGGAGGGAG is described in ClinVar as [Pathogenic]. Clinvar id is 236219.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RERE	NM_001042681.2	c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr758fs	frameshift_variant	18/23	ENST00000400908.7	NP_001036146.1
RERE	NM_012102.4	c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr758fs	frameshift_variant	19/24		NP_036234.3
RERE	NM_001042682.2	c.587_608dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr204fs	frameshift_variant	8/13		NP_001036147.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RERE	ENST00000400908.7	c.2249_2270dupCTCCCTCCTCAGCTCCTCCAGG	p.Thr758fs	frameshift_variant	18/23	1	NM_001042681.2	ENSP00000383700.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jan 08, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs878853252; hg19: chr1-8421296;