10-102504163-TGCGGCCTAGCGGCGCCCCCG-T

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_StrongPM2PP5_Moderate

The NM_016169.4(SUFU):​c.14_33delGGCCTAGCGGCGCCCCCGGC​(p.Arg5ProfsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

SUFU
NM_016169.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 7.45
Variant links:
Genes affected
SUFU (HGNC:16466): (SUFU negative regulator of hedgehog signaling) The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 9 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is Pathogenic according to our data. Variant chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is described in ClinVar as [Pathogenic]. Clinvar id is 2935882.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SUFUNM_016169.4 linkc.14_33delGGCCTAGCGGCGCCCCCGGC p.Arg5ProfsTer36 frameshift_variant Exon 1 of 12 ENST00000369902.8 NP_057253.2 Q9UMX1-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SUFUENST00000369902.8 linkc.14_33delGGCCTAGCGGCGCCCCCGGC p.Arg5ProfsTer36 frameshift_variant Exon 1 of 12 1 NM_016169.4 ENSP00000358918.4 Q9UMX1-1
SUFUENST00000423559.2 linkc.14_33delGGCCTAGCGGCGCCCCCGGC p.Arg5ProfsTer36 frameshift_variant Exon 1 of 10 1 ENSP00000411597.2 Q9UMX1-3
SUFUENST00000369899.6 linkc.14_33delGGCCTAGCGGCGCCCCCGGC p.Arg5ProfsTer36 frameshift_variant Exon 1 of 11 1 ENSP00000358915.2 Q9UMX1-2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Gorlin syndrome;C0025149:Medulloblastoma Pathogenic:1
Mar 24, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with SUFU-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Arg5Profs*36) in the SUFU gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SUFU are known to be pathogenic (PMID: 22508808, 25403219, 33024317). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr10-104263920; API