10-102504163-TGCGGCCTAGCGGCGCCCCCG-T

Position:

• chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_016169.4(SUFU):​c.14_33delGGCCTAGCGGCGCCCCCGGC​(p.Arg5fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SUFU NM_016169.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.45

Genes affected

SUFU (HGNC:16466): (SUFU negative regulator of hedgehog signaling) The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 9 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is Pathogenic according to our data. Variant chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is described in ClinVar as [Pathogenic]. Clinvar id is 2935882.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SUFU	NM_016169.4	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5fs	frameshift_variant	1/12	ENST00000369902.8	NP_057253.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SUFU	ENST00000369902.8	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5fs	frameshift_variant	1/12	1	NM_016169.4	ENSP00000358918.4
SUFU	ENST00000423559.2	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5fs	frameshift_variant	1/10	1		ENSP00000411597.2
SUFU	ENST00000369899.6	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5fs	frameshift_variant	1/11	1		ENSP00000358915.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Gorlin syndrome;C0025149:Medulloblastoma Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Mar 24, 2023

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with SUFU-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Arg5Profs*36) in the SUFU gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SUFU are known to be pathogenic (PMID: 22508808, 25403219, 33024317). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr10-104263920;