10-102504163-TGCGGCCTAGCGGCGCCCCCG-T

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_016169.4(SUFU):​c.14_33delGGCCTAGCGGCGCCCCCGGC​(p.Arg5ProfsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R5R) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

SUFU
NM_016169.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 7.45
Variant links:
Genes affected
SUFU (HGNC:16466): (SUFU negative regulator of hedgehog signaling) The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 57 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is Pathogenic according to our data. Variant chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is described in ClinVar as [Pathogenic]. Clinvar id is 2935882.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SUFUNM_016169.4 linkc.14_33delGGCCTAGCGGCGCCCCCGGC p.Arg5ProfsTer36 frameshift_variant Exon 1 of 12 ENST00000369902.8 NP_057253.2 Q9UMX1-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SUFUENST00000369902.8 linkc.14_33delGGCCTAGCGGCGCCCCCGGC p.Arg5ProfsTer36 frameshift_variant Exon 1 of 12 1 NM_016169.4 ENSP00000358918.4 Q9UMX1-1
SUFUENST00000423559.2 linkc.14_33delGGCCTAGCGGCGCCCCCGGC p.Arg5ProfsTer36 frameshift_variant Exon 1 of 10 1 ENSP00000411597.2 Q9UMX1-3
SUFUENST00000369899.6 linkc.14_33delGGCCTAGCGGCGCCCCCGGC p.Arg5ProfsTer36 frameshift_variant Exon 1 of 11 1 ENSP00000358915.2 Q9UMX1-2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Gorlin syndrome;C0025149:Medulloblastoma Pathogenic:1
Mar 24, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with SUFU-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Arg5Profs*36) in the SUFU gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SUFU are known to be pathogenic (PMID: 22508808, 25403219, 33024317). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr10-104263920; API