chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T

Variant names:

• chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T
• NM_016169.4:c.14_33delGGCCTAGCGGCGCCCCCGGC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_016169.4(SUFU):​c.14_33delGGCCTAGCGGCGCCCCCGGC​(p.Arg5ProfsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SUFU NM_016169.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.45

Genes affected

SUFU (HGNC:16466): (SUFU negative regulator of hedgehog signaling) The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 9 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is Pathogenic according to our data. Variant chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is described in ClinVar as [Pathogenic]. Clinvar id is 2935882.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SUFU	NM_016169.4	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5ProfsTer36	frameshift_variant	Exon 1 of 12	ENST00000369902.8	NP_057253.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SUFU	ENST00000369902.8	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5ProfsTer36	frameshift_variant	Exon 1 of 12	1	NM_016169.4	ENSP00000358918.4
SUFU	ENST00000423559.2	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5ProfsTer36	frameshift_variant	Exon 1 of 10	1		ENSP00000411597.2
SUFU	ENST00000369899.6	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5ProfsTer36	frameshift_variant	Exon 1 of 11	1		ENSP00000358915.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Gorlin syndrome;C0025149:Medulloblastoma Pathogenic:1

Mar 24, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with SUFU-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Arg5Profs*36) in the SUFU gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SUFU are known to be pathogenic (PMID: 22508808, 25403219, 33024317). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr10-104263920;