chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_016169.4(SUFU):c.14_33delGGCCTAGCGGCGCCCCCGGC(p.Arg5ProfsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R5R) has been classified as Likely benign.
Frequency
Consequence
NM_016169.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- medulloblastomaInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- nevoid basal cell carcinoma syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Illumina, Genomics England PanelApp, Orphanet
- basal cell nevus syndrome 2Inheritance: AD Classification: STRONG Submitted by: G2P
- neurodevelopmental disorderInheritance: AD Classification: STRONG Submitted by: PanelApp Australia
- ocular motor apraxia, Cogan typeInheritance: AD Classification: STRONG Submitted by: Franklin by Genoox
- Joubert syndrome 32Inheritance: AR Classification: STRONG, LIMITED Submitted by: G2P, PanelApp Australia, Labcorp Genetics (formerly Invitae), Ambry Genetics
- Joubert syndromeInheritance: AD, AR Classification: MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
- apraxiaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- ciliopathyInheritance: AR Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_016169.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SUFU | TSL:1 MANE Select | c.14_33delGGCCTAGCGGCGCCCCCGGC | p.Arg5ProfsTer36 | frameshift | Exon 1 of 12 | ENSP00000358918.4 | Q9UMX1-1 | ||
| SUFU | TSL:1 | c.14_33delGGCCTAGCGGCGCCCCCGGC | p.Arg5ProfsTer36 | frameshift | Exon 1 of 10 | ENSP00000411597.2 | Q9UMX1-3 | ||
| SUFU | TSL:1 | c.14_33delGGCCTAGCGGCGCCCCCGGC | p.Arg5ProfsTer36 | frameshift | Exon 1 of 11 | ENSP00000358915.2 | Q9UMX1-2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at