NM_016169.4:c.14_33delGGCCTAGCGGCGCCCCCGGC

Variant names:

• chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T
• NM_016169.4:c.14_33delGGCCTAGCGGCGCCCCCGGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_016169.4(SUFU):​c.14_33delGGCCTAGCGGCGCCCCCGGC​(p.Arg5ProfsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R5R) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: SUFU NM_016169.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.45
• Publications: 0 publications found

Genes affected

SUFU (HGNC:16466): (SUFU negative regulator of hedgehog signaling) The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]

SUFU Gene-Disease associations (from GenCC):

• medulloblastoma

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• nevoid basal cell carcinoma syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Illumina, Genomics England PanelApp, Orphanet
• basal cell nevus syndrome 2

  Inheritance: AD Classification: STRONG Submitted by: G2P
• neurodevelopmental disorder

  Inheritance: AD Classification: STRONG Submitted by: PanelApp Australia
• ocular motor apraxia, Cogan type

  Inheritance: AD Classification: STRONG Submitted by: Franklin by Genoox
• Joubert syndrome 32

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: G2P, PanelApp Australia, Labcorp Genetics (formerly Invitae), Ambry Genetics
• Joubert syndrome

  Inheritance: AD, AR Classification: MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
• apraxia

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• ciliopathy

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 87 pathogenic variants in the truncated region.
• PP5: Variant 10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is Pathogenic according to our data. Variant chr10-102504163-TGCGGCCTAGCGGCGCCCCCG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 2935882.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_016169.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SUFU	NM_016169.4	MANE Select	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5ProfsTer36	frameshift	Exon 1 of 12	NP_057253.2
	SUFU	NM_001178133.2		c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5ProfsTer36	frameshift	Exon 1 of 11	NP_001171604.1	Q9UMX1-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SUFU	ENST00000369902.8	TSL:1 MANE Select	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5ProfsTer36	frameshift	Exon 1 of 12	ENSP00000358918.4	Q9UMX1-1
	SUFU	ENST00000423559.2	TSL:1	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5ProfsTer36	frameshift	Exon 1 of 10	ENSP00000411597.2	Q9UMX1-3
	SUFU	ENST00000369899.6	TSL:1	c.14_33delGGCCTAGCGGCGCCCCCGGC	p.Arg5ProfsTer36	frameshift	Exon 1 of 11	ENSP00000358915.2	Q9UMX1-2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Gorlin syndrome;C0025149:Medulloblastoma (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr10-104263920;