10-48869-CCAGCGGAGTCGATGGCATGTT-C

Position:

• chr10-48869-CCAGCGGAGTCGATGGCATGTT-C

Variant summary

Our verdict is Uncertain significance. Variant got 5 ACMG points: 5P and 0B. PM2 PM4 PP5

The NM_177987.3(TUBB8):​c.80_100delAACATGCCATCGACTCCGCTG​(p.Glu27_Ala33del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TUBB8 NM_177987.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 6.97

Genes affected

TUBB8 (HGNC:20773): (tubulin beta 8 class VIII) The protein encoded by this gene represents the primary beta-tubulin subunit of oocytes and the early embryo. Defects in this gene, which is primate-specific, are a cause of oocyte maturation defect 2 and infertility. [provided by RefSeq, Mar 2016]

TUBB8 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 5 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_177987.3.
• PP5: Variant 10-48869-CCAGCGGAGTCGATGGCATGTT-C is Pathogenic according to our data. Variant chr10-48869-CCAGCGGAGTCGATGGCATGTT-C is described in ClinVar as [Pathogenic]. Clinvar id is 378060.Status of the report is no_assertion_criteria_provided, 0 stars. Variant chr10-48869-CCAGCGGAGTCGATGGCATGTT-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
TUBB8	NM_177987.3	c.80_100delAACATGCCATCGACTCCGCTG	p.Glu27_Ala33del	disruptive_inframe_deletion	2/4	ENST00000568584.6	NP_817124.1
TUBB8	XM_047425177.1	c.4_24delAACATGCCATCGACTCCGCTG	p.Asn2_Leu8del	conservative_inframe_deletion	1/4		XP_047281133.1
TUBB8	NM_001389618.1	c.-137_-117delAACATGCCATCGACTCCGCTG		5_prime_UTR_variant	3/5		NP_001376547.1
TUBB8	NM_001389619.1	c.-137_-117delAACATGCCATCGACTCCGCTG		5_prime_UTR_variant	3/5		NP_001376548.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
TUBB8	ENST00000568584.6	c.80_100delAACATGCCATCGACTCCGCTG	p.Glu27_Ala33del	disruptive_inframe_deletion	2/4	1	NM_177987.3	ENSP00000456206.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Oocyte maturation defect 2 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Apr 10, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1057520307; hg19: chr10-94809;